11-88291569-TGAAAGAAAGAAAGAAAGAAAGAAA-TGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAA

Variant names:

• chr11-88291569-T-TGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAA
• rs36141641
• ENST00000678554.1:n.890-1063_890-1062insTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTC

Variant summary

Our verdict is Uncertain significance. Variant got 0 ACMG points: 0P and 0B.

The ENST00000678554.1(CTSC):​n.890-1063_890-1062insTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTC variant causes a intron change involving the alteration of a non-conserved nucleotide. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: 𝑓 0.0000079 (0 hom., cov: 0)
• Consequence: CTSC ENST00000678554.1 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: -0.799

Genes affected

CTSC (HGNC:2528): (cathepsin C) This gene encodes a member of the peptidase C1 family and lysosomal cysteine proteinase that appears to be a central coordinator for activation of many serine proteinases in cells of the immune system. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate heavy and light chains that form a disulfide-linked dimer. A portion of the propeptide acts as an intramolecular chaperone for the folding and stabilization of the mature enzyme. This enzyme requires chloride ions for activity and can degrade glucagon. Defects in the encoded protein have been shown to be a cause of Papillon-Lefevre syndrome, an autosomal recessive disorder characterized by palmoplantar keratosis and periodontitis. [provided by RefSeq, Nov 2015]

ACMG classification

Verdict is Uncertain_significance. Variant got 0 ACMG points.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CTSC	ENST00000678554.1	n.890-1063_890-1062insTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTC		intron_variant	Intron 6 of 7			ENSP00000504541.1

Frequencies

GnomAD3 genomes AF: 0.00000791 AC: 1 AN: 126382 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.0000326

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome AF: 0.00000791 AC: 1 AN: 126382 Hom.: 0 Cov.: 0 AF XY: 0.00 AC XY: 0 AN XY: 60192

Gnomad4 AFR AF: 0.0000326

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.00

Gnomad4 OTH AF: 0.00

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs36141641; hg19: chr11-88024737;