12-102958393-CGCAGCAGCAGCAGCAGCAGCAGCAGCA-CGCA

Variant names:

• chr12-102958393-CGCAGCAGCAGCAGCAGCAGCAGCA-C
• rs3832799
• NM_004316.4:c.163_186delCAGCAGCAGCAGCAGCAGCAGCAG

Variant summary

Our verdict is Likely benign. The variant received -2 ACMG points: 0P and 2B. BP6_Moderate

The NM_004316.4(ASCL1):​c.163_186delCAGCAGCAGCAGCAGCAGCAGCAG​(p.Gln55_Gln62del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00049 in 1,507,148 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★).

• Frequency:
  • Genomes: 𝑓 0.00031 (0 hom., cov: 0)
  • Exomes 𝑓: 0.00051 (0 hom.)
• Consequence: ASCL1 NM_004316.4 conservative_inframe_deletion
• Clinical Significance: Likely benign criteria provided, single submitter B:2
• Conservation: PhyloP100: 0.809
• Publications: 15 publications found

Genes affected

ASCL1 (HGNC:738): (achaete-scute family bHLH transcription factor 1) This gene encodes a member of the basic helix-loop-helix (BHLH) family of transcription factors. The protein activates transcription by binding to the E box (5'-CANNTG-3'). Dimerization with other BHLH proteins is required for efficient DNA binding. This protein plays a role in the neuronal commitment and differentiation and in the generation of olfactory and autonomic neurons. Mutations in this gene may contribute to the congenital central hypoventilation syndrome (CCHS) phenotype in rare cases. [provided by RefSeq, Jul 2008]

PAH (HGNC:8582): (phenylalanine hydroxylase) This gene encodes a member of the biopterin-dependent aromatic amino acid hydroxylase protein family. The encoded phenylalanine hydroxylase enzyme hydroxylates phenylalanine to tyrosine and is the rate-limiting step in phenylalanine catabolism. Deficiency of this enzyme activity results in the autosomal recessive disorder phenylketonuria. [provided by RefSeq, Aug 2017]

PAH Gene-Disease associations (from GenCC):

• phenylketonuria

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P, ClinGen, Myriad Women’s Health
• classic phenylketonuria

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• maternal phenylketonuria

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• mild hyperphenylalaninemia

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• mild phenylketonuria

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• tetrahydrobiopterin-responsive hyperphenylalaninemia/phenylketonuria

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_benign. The variant received -2 ACMG points.

• BP6: Variant 12-102958393-CGCAGCAGCAGCAGCAGCAGCAGCA-C is Benign according to our data. Variant chr12-102958393-CGCAGCAGCAGCAGCAGCAGCAGCA-C is described in ClinVar as [Likely_benign]. Clinvar id is 597419.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ASCL1	NM_004316.4	c.163_186delCAGCAGCAGCAGCAGCAGCAGCAG	p.Gln55_Gln62del	conservative_inframe_deletion	Exon 1 of 2	ENST00000266744.4	NP_004307.2
PAH		n.102958417_102958394delTGCTGCTGCTGCTGCTGCTGCTGC		bidirectional_gene_fusion
PAH	NM_001354304.2	c.-318_-295delTGCTGCTGCTGCTGCTGCTGCTGC		5_prime_UTR_variant	Exon 1 of 14		NP_001341233.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ASCL1	ENST00000266744.4	c.163_186delCAGCAGCAGCAGCAGCAGCAGCAG	p.Gln55_Gln62del	conservative_inframe_deletion	Exon 1 of 2	1	NM_004316.4	ENSP00000266744.3

Frequencies

GnomAD3 genomes AF: 0.000313 AC: 47 AN: 150120 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.000171

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00139

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.0000985

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000267

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.000510 AC: 692 AN: 1356938 Hom.: 0 AF XY: 0.000496 AC XY: 332 AN XY: 669234

African (AFR) AF: 0.0000701 AC: 2 AN: 28512

American (AMR) AF: 0.000475 AC: 16 AN: 33686

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 24016

East Asian (EAS) AF: 0.00 AC: 0 AN: 33382

South Asian (SAS) AF: 0.0000263 AC: 2 AN: 75996

European-Finnish (FIN) AF: 0.0000485 AC: 2 AN: 41214

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 4084

European-Non Finnish (NFE) AF: 0.000613 AC: 649 AN: 1059582

Other (OTH) AF: 0.000372 AC: 21 AN: 56466

GnomAD4 genome AF: 0.000313 AC: 47 AN: 150210 Hom.: 0 Cov.: 0 AF XY: 0.000355 AC XY: 26 AN XY: 73326

African (AFR) AF: 0.000171 AC: 7 AN: 40994

American (AMR) AF: 0.00139 AC: 21 AN: 15154

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3456

East Asian (EAS) AF: 0.00 AC: 0 AN: 5054

South Asian (SAS) AF: 0.00 AC: 0 AN: 4762

European-Finnish (FIN) AF: 0.0000985 AC: 1 AN: 10154

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 290

European-Non Finnish (NFE) AF: 0.000267 AC: 18 AN: 67372

Other (OTH) AF: 0.00 AC: 0 AN: 2072

Alfa AF: 0.00 Hom.: 277

ClinVar

Significance: Likely benign

Submissions summary: Benign:2

Revision: criteria provided, single submitter

Submissions by phenotype

not specified Benign:1

Jun 14, 2018

Eurofins Ntd Llc (ga)

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

ASCL1-related disorder Benign:1

Aug 30, 2024

PreventionGenetics, part of Exact Sciences

Significance: Likely benign

Review Status: no assertion criteria provided

Collection Method: clinical testing

This variant is classified as likely benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications). -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.81
Mutation Taster		=143/57	disease causing (fs/PTC)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs3832799; hg19: chr12-103352171;