chr12-102958393-CGCAGCAGCAGCAGCAGCAGCAGCA-C
Variant summary
Our verdict is Likely benign. The variant received -2 ACMG points: 0P and 2B. BP6_Moderate
The NM_004316.4(ASCL1):c.163_186delCAGCAGCAGCAGCAGCAGCAGCAG(p.Gln55_Gln62del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00049 in 1,507,148 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★).
Frequency
Consequence
NM_004316.4 conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- phenylketonuriaInheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), ClinGen, Myriad Women’s Health, G2P
- classic phenylketonuriaInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- maternal phenylketonuriaInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- mild hyperphenylalaninemiaInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- mild phenylketonuriaInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- tetrahydrobiopterin-responsive hyperphenylalaninemia/phenylketonuriaInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_004316.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ASCL1 | MANE Select | c.163_186delCAGCAGCAGCAGCAGCAGCAGCAG | p.Gln55_Gln62del | conservative_inframe_deletion | Exon 1 of 2 | NP_004307.2 | P50553 | ||
| PAH | c.-318_-295delTGCTGCTGCTGCTGCTGCTGCTGC | 5_prime_UTR | Exon 1 of 14 | NP_001341233.1 | P00439 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ASCL1 | TSL:1 MANE Select | c.163_186delCAGCAGCAGCAGCAGCAGCAGCAG | p.Gln55_Gln62del | conservative_inframe_deletion | Exon 1 of 2 | ENSP00000266744.3 | P50553 | ||
| PAH | TSL:4 | n.-7_17delTGCTGCTGCTGCTGCTGCTGCTGC | non_coding_transcript_exon | Exon 1 of 3 | |||||
| PAH | TSL:3 | c.-318_-295delTGCTGCTGCTGCTGCTGCTGCTGC | upstream_gene | N/A | ENSP00000447620.1 | F8W0A0 |
Frequencies
GnomAD3 genomes AF: 0.000313 AC: 47AN: 150120Hom.: 0 Cov.: 0 show subpopulations
GnomAD4 exome AF: 0.000510 AC: 692AN: 1356938Hom.: 0 AF XY: 0.000496 AC XY: 332AN XY: 669234 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.000313 AC: 47AN: 150210Hom.: 0 Cov.: 0 AF XY: 0.000355 AC XY: 26AN XY: 73326 show subpopulations
Age Distribution
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at