12-5044331-TCGGGAGTGCGGCCCTTGCCTCCGCTGCCGGACC-T
Variant summary
Our verdict is Likely benign. Variant got -3 ACMG points: 2P and 5B. PM4BP6BS2
The NM_002234.4(KCNA5):c.213_245delGGACCCGGGAGTGCGGCCCTTGCCTCCGCTGCC(p.Asp72_Pro82del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.000545 in 152,242 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).
Frequency
Consequence
NM_002234.4 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Likely_benign. Variant got -3 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes AF: 0.000546 AC: 83AN: 152124Hom.: 0 Cov.: 33
GnomAD3 exomes AF: 0.000858 AC: 132AN: 153812Hom.: 0 AF XY: 0.00100 AC XY: 85AN XY: 84636
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000918 AC: 1284AN: 1398538Hom.: 1 AF XY: 0.000954 AC XY: 659AN XY: 690980
GnomAD4 genome AF: 0.000545 AC: 83AN: 152242Hom.: 0 Cov.: 33 AF XY: 0.000457 AC XY: 34AN XY: 74444
ClinVar
Submissions by phenotype
Atrial fibrillation, familial, 7 Uncertain:2Benign:1
- -
- -
The KCNA5 c.213_245del, p.Asp72_Pro82del variant (rs144879674) is reported in the literature in two probands affected with atrial fibrillation as well as three affected relatives (Yang 2010). This variant results in an in-frame deletion of 11 residues that encompass a predicted Src SH2 domain binding motif and functional analysis demonstrated that this variant reduces channel activity; however, the clinical relevance of this observation is unknown. (Yang 2010). This variant is reported in ClinVar (Variation ID: 537316) and is found in the general population with an overall allele frequency of 0.079% (147/185,166 alleles) and a South Asian allele frequency of 0.24% in the Genome Aggregation Database. Due to limited information, the clinical significance of this variant is uncertain at this time. -
not specified Benign:1
- -
not provided Benign:1
This variant is associated with the following publications: (PMID: 32577384, 20638934, 32397294) -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at