12-5044331-TCGGGAGTGCGGCCCTTGCCTCCGCTGCCGGACC-T
Variant summary
Our verdict is Likely benign. The variant received -3 ACMG points: 2P and 5B. PM4BP6BS2
The NM_002234.4(KCNA5):c.213_245delGGACCCGGGAGTGCGGCCCTTGCCTCCGCTGCC(p.Asp72_Pro82del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.000545 in 152,242 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).
Frequency
Consequence
NM_002234.4 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- atrial fibrillation, familial, 7Inheritance: AD Classification: MODERATE, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics
- familial atrial fibrillationInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -3 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_002234.4. You can select a different transcript below to see updated ACMG assignments.
Frequencies
GnomAD3 genomes AF: 0.000546 AC: 83AN: 152124Hom.: 0 Cov.: 33 show subpopulations
GnomAD2 exomes AF: 0.000858 AC: 132AN: 153812 AF XY: 0.00100 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000918 AC: 1284AN: 1398538Hom.: 1 AF XY: 0.000954 AC XY: 659AN XY: 690980 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome AF: 0.000545 AC: 83AN: 152242Hom.: 0 Cov.: 33 AF XY: 0.000457 AC XY: 34AN XY: 74444 show subpopulations
Age Distribution
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at