chr12-5044331-TCGGGAGTGCGGCCCTTGCCTCCGCTGCCGGACC-T
Variant summary
Our verdict is Likely benign. The variant received -3 ACMG points: 2P and 5B. PM4BP6BS2
The NM_002234.4(KCNA5):c.213_245delGGACCCGGGAGTGCGGCCCTTGCCTCCGCTGCC(p.Asp72_Pro82del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.000545 in 152,242 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).
Frequency
Consequence
NM_002234.4 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- atrial fibrillation, familial, 7Inheritance: AD Classification: MODERATE, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics
- familial atrial fibrillationInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -3 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| KCNA5 | NM_002234.4 | c.213_245delGGACCCGGGAGTGCGGCCCTTGCCTCCGCTGCC | p.Asp72_Pro82del | disruptive_inframe_deletion | Exon 1 of 1 | ENST00000252321.5 | NP_002225.2 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| KCNA5 | ENST00000252321.5 | c.213_245delGGACCCGGGAGTGCGGCCCTTGCCTCCGCTGCC | p.Asp72_Pro82del | disruptive_inframe_deletion | Exon 1 of 1 | 6 | NM_002234.4 | ENSP00000252321.3 |
Frequencies
GnomAD3 genomes AF: 0.000546 AC: 83AN: 152124Hom.: 0 Cov.: 33 show subpopulations
GnomAD2 exomes AF: 0.000858 AC: 132AN: 153812 AF XY: 0.00100 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000918 AC: 1284AN: 1398538Hom.: 1 AF XY: 0.000954 AC XY: 659AN XY: 690980 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome AF: 0.000545 AC: 83AN: 152242Hom.: 0 Cov.: 33 AF XY: 0.000457 AC XY: 34AN XY: 74444 show subpopulations
Age Distribution
ClinVar
Submissions by phenotype
Atrial fibrillation, familial, 7 Uncertain:2Benign:1
The KCNA5 c.213_245del, p.Asp72_Pro82del variant (rs144879674) is reported in the literature in two probands affected with atrial fibrillation as well as three affected relatives (Yang 2010). This variant results in an in-frame deletion of 11 residues that encompass a predicted Src SH2 domain binding motif and functional analysis demonstrated that this variant reduces channel activity; however, the clinical relevance of this observation is unknown. (Yang 2010). This variant is reported in ClinVar (Variation ID: 537316) and is found in the general population with an overall allele frequency of 0.079% (147/185,166 alleles) and a South Asian allele frequency of 0.24% in the Genome Aggregation Database. Due to limited information, the clinical significance of this variant is uncertain at this time. -
- -
- -
not specified Benign:1
- -
not provided Benign:1
This variant is associated with the following publications: (PMID: 32577384, 20638934, 32397294) -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at