chr12-5044331-TCGGGAGTGCGGCCCTTGCCTCCGCTGCCGGACC-T

Variant names:

• chr12-5044331-TCGGGAGTGCGGCCCTTGCCTCCGCTGCCGGACC-T
• rs144879674
• NM_002234.4:c.213_245delGGACCCGGGAGTGCGGCCCTTGCCTCCGCTGCC

Variant summary

Our verdict is Likely benign. Variant got -3 ACMG points: 2P and 5B. PM4 BP6 BS2

The NM_002234.4(KCNA5):​c.213_245delGGACCCGGGAGTGCGGCCCTTGCCTCCGCTGCC​(p.Asp72_Pro82del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.000545 in 152,242 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency:
  • Genomes: 𝑓 0.00055 (0 hom., cov: 33)
  • Exomes 𝑓: 0.00092 (1 hom.)
  • Failed GnomAD Quality Control
• Consequence: KCNA5 NM_002234.4 disruptive_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:2 B:3
• Conservation: PhyloP100: 4.17

Genes affected

KCNA5 (HGNC:6224): (potassium voltage-gated channel subfamily A member 5) Potassium channels represent the most complex class of voltage-gated ino channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It belongs to the delayed rectifier class, the function of which could restore the resting membrane potential of beta cells after depolarization and thereby contribute to the regulation of insulin secretion. This gene is intronless, and the gene is clustered with genes KCNA1 and KCNA6 on chromosome 12. Defects in this gene are a cause of familial atrial fibrillation type 7 (ATFB7). [provided by RefSeq, May 2012]

ACMG classification

Verdict is Likely_benign. Variant got -3 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_002234.4.
• BP6: Variant 12-5044331-TCGGGAGTGCGGCCCTTGCCTCCGCTGCCGGACC-T is Benign according to our data. Variant chr12-5044331-TCGGGAGTGCGGCCCTTGCCTCCGCTGCCGGACC-T is described in ClinVar as [Conflicting_classifications_of_pathogenicity]. Clinvar id is 537316.We mark this variant Likely_benign, oryginal submissions are: {Uncertain_significance=2, Likely_benign=3}. Variant chr12-5044331-TCGGGAGTGCGGCCCTTGCCTCCGCTGCCGGACC-T is described in Lovd as [Likely_benign].
• BS2: High AC in GnomAd4 at 83 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
KCNA5	NM_002234.4	c.213_245delGGACCCGGGAGTGCGGCCCTTGCCTCCGCTGCC	p.Asp72_Pro82del	disruptive_inframe_deletion	Exon 1 of 1	ENST00000252321.5	NP_002225.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
KCNA5	ENST00000252321.5	c.213_245delGGACCCGGGAGTGCGGCCCTTGCCTCCGCTGCC	p.Asp72_Pro82del	disruptive_inframe_deletion	Exon 1 of 1	6	NM_002234.4	ENSP00000252321.3

Frequencies

GnomAD3 genomes AF: 0.000546 AC: 83 AN: 152124 Hom.: 0 Cov.: 33

Gnomad AFR AF: 0.000338

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000589

Gnomad ASJ AF: 0.000288

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.000415

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000838

Gnomad OTH AF: 0.00

GnomAD3 exomes AF: 0.000858 AC: 132 AN: 153812 Hom.: 0 AF XY: 0.00100 AC XY: 85 AN XY: 84636

Gnomad AFR exome AF: 0.000353

Gnomad AMR exome AF: 0.000697

Gnomad ASJ exome AF: 0.000244

Gnomad EAS exome AF: 0.0000815

Gnomad SAS exome AF: 0.00235

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.000805

Gnomad OTH exome AF: 0.000229

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000918 AC: 1284 AN: 1398538 Hom.: 1 AF XY: 0.000954 AC XY: 659 AN XY: 690980

Gnomad4 AFR exome AF: 0.000247

Gnomad4 AMR exome AF: 0.000594

Gnomad4 ASJ exome AF: 0.000279

Gnomad4 EAS exome AF: 0.0000808

Gnomad4 SAS exome AF: 0.00208

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.000956

Gnomad4 OTH exome AF: 0.000652

GnomAD4 genome AF: 0.000545 AC: 83 AN: 152242 Hom.: 0 Cov.: 33 AF XY: 0.000457 AC XY: 34 AN XY: 74444

Gnomad4 AFR AF: 0.000337

Gnomad4 AMR AF: 0.000588

Gnomad4 ASJ AF: 0.000288

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.000415

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.000838

Gnomad4 OTH AF: 0.00

Alfa AF: 0.000384 Hom.: 0

Bravo AF: 0.000578

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Uncertain:2 Benign:3

Revision: criteria provided, conflicting classifications

Submissions by phenotype

Atrial fibrillation, familial, 7 Uncertain:2 Benign:1

Uncertain significance, criteria provided, single submitter	clinical testing	Revvity Omics, Revvity	Feb 02, 2022	- -
Likely benign, criteria provided, single submitter	clinical testing	Labcorp Genetics (formerly Invitae), Labcorp	Jan 29, 2025	- -
Uncertain significance, criteria provided, single submitter	clinical testing	ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories	Sep 15, 2019	The KCNA5 c.213_245del, p.Asp72_Pro82del variant (rs144879674) is reported in the literature in two probands affected with atrial fibrillation as well as three affected relatives (Yang 2010). This variant results in an in-frame deletion of 11 residues that encompass a predicted Src SH2 domain binding motif and functional analysis demonstrated that this variant reduces channel activity; however, the clinical relevance of this observation is unknown. (Yang 2010). This variant is reported in ClinVar (Variation ID: 537316) and is found in the general population with an overall allele frequency of 0.079% (147/185,166 alleles) and a South Asian allele frequency of 0.24% in the Genome Aggregation Database. Due to limited information, the clinical significance of this variant is uncertain at this time. -

not specified Benign:1

Likely benign, criteria provided, single submitter

clinical testing

Women's Health and Genetics/Laboratory Corporation of America, LabCorp

Aug 27, 2024

- -

not provided Benign:1

Likely benign, criteria provided, single submitter

clinical testing

GeneDx

Dec 09, 2020

This variant is associated with the following publications: (PMID: 32577384, 20638934, 32397294) -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs144879674; hg19: chr12-5153497;