12-5044331-TCGGGAGTGCGGCCCTTGCCTCCGCTGCCGGACC-TCGGGAGTGCGGCCCTTGCCTCCGCTGCCGGACCCGGGAGTGCGGCCCTTGCCTCCGCTGCCGGACC
Variant summary
Our verdict is Likely benign. Variant got -2 ACMG points: 2P and 4B. PM4BS2
The NM_002234.4(KCNA5):c.213_245dup(p.Asp72_Pro82dup) variant causes a inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000206 in 1,550,718 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. S62S) has been classified as Likely benign.
Frequency
Consequence
NM_002234.4 inframe_insertion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Likely_benign. Variant got -2 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | UniProt |
---|---|---|---|---|---|---|---|
KCNA5 | NM_002234.4 | c.213_245dup | p.Asp72_Pro82dup | inframe_insertion | 1/1 | ENST00000252321.5 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|
KCNA5 | ENST00000252321.5 | c.213_245dup | p.Asp72_Pro82dup | inframe_insertion | 1/1 | NM_002234.4 | P1 |
Frequencies
GnomAD3 genomes AF: 0.0000329 AC: 5AN: 152126Hom.: 0 Cov.: 33
GnomAD3 exomes AF: 0.0000455 AC: 7AN: 153812Hom.: 0 AF XY: 0.0000354 AC XY: 3AN XY: 84636
GnomAD4 exome AF: 0.0000193 AC: 27AN: 1398592Hom.: 0 Cov.: 30 AF XY: 0.0000203 AC XY: 14AN XY: 691006
GnomAD4 genome AF: 0.0000329 AC: 5AN: 152126Hom.: 0 Cov.: 33 AF XY: 0.0000135 AC XY: 1AN XY: 74318
ClinVar
Submissions by phenotype
Atrial fibrillation, familial, 7 Uncertain:1
Uncertain significance, criteria provided, single submitter | clinical testing | Labcorp Genetics (formerly Invitae), Labcorp | Oct 29, 2023 | This variant, c.213_245dup, results in the insertion of 11 amino acid(s) of the KCNA5 protein (p.Asp72_Pro82dup), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (no rsID available, gnomAD 0.05%). This variant has not been reported in the literature in individuals affected with KCNA5-related conditions. ClinVar contains an entry for this variant (Variation ID: 469589). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. - |
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at