12-52949365-CACCGGGATAGCCGGGGGTCTGGCA-C

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PM1PM2PM4

The NM_000224.3(KRT18):​c.193_216delACCGGGATAGCCGGGGGTCTGGCA​(p.Thr65_Ala72del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as not provided (no stars).

Frequency

Genomes: not found (cov: 37)

Consequence

KRT18
NM_000224.3 conservative_inframe_deletion

Scores

Not classified

Clinical Significance

not provided no classification provided O:1

Conservation

PhyloP100: 3.28
Variant links:
Genes affected
KRT18 (HGNC:6430): (keratin 18) KRT18 encodes the type I intermediate filament chain keratin 18. Keratin 18, together with its filament partner keratin 8, are perhaps the most commonly found members of the intermediate filament gene family. They are expressed in single layer epithelial tissues of the body. Mutations in this gene have been linked to cryptogenic cirrhosis. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
KRT8 (HGNC:6446): (keratin 8) This gene is a member of the type II keratin family clustered on the long arm of chromosome 12. Type I and type II keratins heteropolymerize to form intermediate-sized filaments in the cytoplasm of epithelial cells. The product of this gene typically dimerizes with keratin 18 to form an intermediate filament in simple single-layered epithelial cells. This protein plays a role in maintaining cellular structural integrity and also functions in signal transduction and cellular differentiation. Mutations in this gene cause cryptogenic cirrhosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

PM1
In a modified_residue Phosphothreonine (size 0) in uniprot entity K1C18_HUMAN
PM2
Very rare variant in population databases, with high coverage;
PM4
Nonframeshift variant in NON repetitive region in NM_000224.3.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
KRT18NM_000224.3 linkc.193_216delACCGGGATAGCCGGGGGTCTGGCA p.Thr65_Ala72del conservative_inframe_deletion Exon 1 of 7 ENST00000388835.4 NP_000215.1 P05783A0A024RAY2
KRT18NM_199187.2 linkc.193_216delACCGGGATAGCCGGGGGTCTGGCA p.Thr65_Ala72del conservative_inframe_deletion Exon 2 of 8 NP_954657.1 P05783A0A024RAY2
KRT8NM_001256293.2 linkc.-47+326_-47+349delTGCCAGACCCCCGGCTATCCCGGT intron_variant Intron 1 of 8 NP_001243222.1 P05787-1
KRT8NR_045962.2 linkn.405+67_405+90delTGCCAGACCCCCGGCTATCCCGGT intron_variant Intron 1 of 8

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
KRT18ENST00000388835.4 linkc.193_216delACCGGGATAGCCGGGGGTCTGGCA p.Thr65_Ala72del conservative_inframe_deletion Exon 1 of 7 1 NM_000224.3 ENSP00000373487.3 P05783

Frequencies

GnomAD3 genomes
Cov.:
37
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
37

ClinVar

Significance: not provided
Submissions summary: Other:1
Revision: no classification provided
LINK: link

Submissions by phenotype

not provided Other:1
-
Epithelial Biology; Institute of Medical Biology, Singapore
Significance: not provided
Review Status: no classification provided
Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs267607417; hg19: chr12-53343149; API