12-6936728-ACAGCAGCAGCAGCAGCAGCAGCAG-A

Variant names:

• chr12-6936728-ACAGCAGCAGCAGCAGCAGCAGCAG-A
• rs60216939
• NM_001940.4:c.1485_1508delGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Benign. The variant received -12 ACMG points: 0P and 12B. BP6_Very_Strong BS2

The NM_001940.4(ATN1):​c.1485_1508delGCAGCAGCAGCAGCAGCAGCAGCA​(p.Gln495_Gln502del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.00152 in 1,581,842 control chromosomes in the GnomAD database, including 14 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★).

• Frequency:
  • Genomes: 𝑓 0.0016 (0 hom., cov: 0)
  • Exomes 𝑓: 0.0015 (14 hom.)
• Consequence: ATN1 NM_001940.4 disruptive_inframe_deletion
• Clinical Significance: Likely benign criteria provided, multiple submitters, no conflicts B:3
• Conservation: PhyloP100: 4.09
• Publications: 8 publications found

Genes affected

ATN1 (HGNC:3033): (atrophin 1) Dentatorubral pallidoluysian atrophy (DRPLA) is a rare neurodegenerative disorder characterized by cerebellar ataxia, myoclonic epilepsy, choreoathetosis, and dementia. The disorder is related to the expansion from 7-35 copies to 49-93 copies of a trinucleotide repeat (CAG/CAA) within this gene. The encoded protein includes a serine repeat and a region of alternating acidic and basic amino acids, as well as the variable glutamine repeat. Alternative splicing results in two transcripts variants that encode the same protein. [provided by RefSeq, Jul 2016]

ATN1 Gene-Disease associations (from GenCC):

• congenital hypotonia, epilepsy, developmental delay, and digital anomalies

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: G2P, Labcorp Genetics (formerly Invitae), Illumina, Ambry Genetics
• dentatorubral-pallidoluysian atrophy

  Inheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet

ACMG classification

Our verdict: Benign. The variant received -12 ACMG points.

• BP6: Variant 12-6936728-ACAGCAGCAGCAGCAGCAGCAGCAG-A is Benign according to our data. Variant chr12-6936728-ACAGCAGCAGCAGCAGCAGCAGCAG-A is described in ClinVar as Likely_benign. ClinVar VariationId is 2642646.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS2: High AC in GnomAd4 at 226 AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001940.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ATN1	NM_001940.4	MANE Select	c.1485_1508delGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln495_Gln502del	disruptive_inframe_deletion	Exon 5 of 10	NP_001931.2	P54259
	ATN1	NM_001007026.2		c.1485_1508delGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln495_Gln502del	disruptive_inframe_deletion	Exon 5 of 10	NP_001007027.1	P54259
	ATN1	NM_001424176.1		c.1485_1508delGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln495_Gln502del	disruptive_inframe_deletion	Exon 5 of 10	NP_001411105.1	P54259

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ATN1	ENST00000396684.3	TSL:1 MANE Select	c.1485_1508delGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln495_Gln502del	disruptive_inframe_deletion	Exon 5 of 10	ENSP00000379915.2	P54259
	ATN1	ENST00000356654.8	TSL:1	c.1485_1508delGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln495_Gln502del	disruptive_inframe_deletion	Exon 5 of 10	ENSP00000349076.3	P54259
	ATN1	ENST00000882240.1		c.1485_1508delGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln495_Gln502del	disruptive_inframe_deletion	Exon 5 of 11	ENSP00000552299.1

Frequencies

GnomAD3 genomes AF: 0.00155 AC: 225 AN: 145032 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.000259

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00425

Gnomad ASJ AF: 0.00267

Gnomad EAS AF: 0.0104

Gnomad SAS AF: 0.00271

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.0290

Gnomad NFE AF: 0.00111

Gnomad OTH AF: 0.00153

GnomAD4 exome AF: 0.00152 AC: 2180 AN: 1436710 Hom.: 14 AF XY: 0.00160 AC XY: 1146 AN XY: 715582

African (AFR) AF: 0.000683 AC: 22 AN: 32214

American (AMR) AF: 0.00132 AC: 53 AN: 40066

Ashkenazi Jewish (ASJ) AF: 0.00336 AC: 86 AN: 25612

East Asian (EAS) AF: 0.0120 AC: 464 AN: 38772

South Asian (SAS) AF: 0.00471 AC: 402 AN: 85358

European-Finnish (FIN) AF: 0.0000381 AC: 2 AN: 52540

Middle Eastern (MID) AF: 0.00876 AC: 50 AN: 5710

European-Non Finnish (NFE) AF: 0.000881 AC: 966 AN: 1097062

Other (OTH) AF: 0.00227 AC: 135 AN: 59376

GnomAD4 genome AF: 0.00156 AC: 226 AN: 145132 Hom.: 0 Cov.: 0 AF XY: 0.00167 AC XY: 118 AN XY: 70474

African (AFR) AF: 0.000258 AC: 10 AN: 38764

American (AMR) AF: 0.00424 AC: 59 AN: 13900

Ashkenazi Jewish (ASJ) AF: 0.00267 AC: 9 AN: 3376

East Asian (EAS) AF: 0.0104 AC: 49 AN: 4720

South Asian (SAS) AF: 0.00271 AC: 12 AN: 4430

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10080

Middle Eastern (MID) AF: 0.0347 AC: 10 AN: 288

European-Non Finnish (NFE) AF: 0.00111 AC: 74 AN: 66702

Other (OTH) AF: 0.00151 AC: 3 AN: 1984

Alfa AF: 0.00 Hom.: 123

ClinVar

ClinVar submissions

Significance: Likely benign

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	-	1	Inborn genetic diseases (1)
-	-	1	not provided (1)
-	-	1	not specified (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.1
Mutation Taster		=155/45	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs60216939; hg19: chr12-7045891; COSMIC: COSV63111817; COSMIC: COSV63111817;