12-6936728-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-ACAGCAG

Variant names:

• chr12-6936728-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-A
• rs60216939
• NM_001940.4:c.1479_1508delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Likely benign. The variant received -4 ACMG points: 0P and 4B. BS2

The NM_001940.4(ATN1):​c.1479_1508delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA​(p.Gln493_Gln502del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.000369 in 1,584,052 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.00037 (0 hom., cov: 0)
  • Exomes 𝑓: 0.00037 (0 hom.)
• Consequence: ATN1 NM_001940.4 disruptive_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 4.09
• Publications: 8 publications found

Genes affected

ATN1 (HGNC:3033): (atrophin 1) Dentatorubral pallidoluysian atrophy (DRPLA) is a rare neurodegenerative disorder characterized by cerebellar ataxia, myoclonic epilepsy, choreoathetosis, and dementia. The disorder is related to the expansion from 7-35 copies to 49-93 copies of a trinucleotide repeat (CAG/CAA) within this gene. The encoded protein includes a serine repeat and a region of alternating acidic and basic amino acids, as well as the variable glutamine repeat. Alternative splicing results in two transcripts variants that encode the same protein. [provided by RefSeq, Jul 2016]

ATN1 Gene-Disease associations (from GenCC):

• congenital hypotonia, epilepsy, developmental delay, and digital anomalies

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: G2P, Labcorp Genetics (formerly Invitae), Illumina, Ambry Genetics
• dentatorubral-pallidoluysian atrophy

  Inheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet

ACMG classification

Our verdict: Likely_benign. The variant received -4 ACMG points.

• BS2: High AC in GnomAd4 at 53 AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001940.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ATN1	NM_001940.4	MANE Select	c.1479_1508delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln493_Gln502del	disruptive_inframe_deletion	Exon 5 of 10	NP_001931.2	P54259
	ATN1	NM_001007026.2		c.1479_1508delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln493_Gln502del	disruptive_inframe_deletion	Exon 5 of 10	NP_001007027.1	P54259
	ATN1	NM_001424176.1		c.1479_1508delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln493_Gln502del	disruptive_inframe_deletion	Exon 5 of 10	NP_001411105.1	P54259

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ATN1	ENST00000396684.3	TSL:1 MANE Select	c.1479_1508delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln493_Gln502del	disruptive_inframe_deletion	Exon 5 of 10	ENSP00000379915.2	P54259
	ATN1	ENST00000356654.8	TSL:1	c.1479_1508delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln493_Gln502del	disruptive_inframe_deletion	Exon 5 of 10	ENSP00000349076.3	P54259
	ATN1	ENST00000882240.1		c.1479_1508delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln493_Gln502del	disruptive_inframe_deletion	Exon 5 of 11	ENSP00000552299.1

Frequencies

GnomAD3 genomes AF: 0.000365 AC: 53 AN: 145034 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.000155

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000288

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000845

Gnomad SAS AF: 0.000226

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000570

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.000370 AC: 532 AN: 1438918 Hom.: 0 AF XY: 0.000384 AC XY: 275 AN XY: 716732

African (AFR) AF: 0.000310 AC: 10 AN: 32226

American (AMR) AF: 0.000374 AC: 15 AN: 40114

Ashkenazi Jewish (ASJ) AF: 0.000234 AC: 6 AN: 25686

East Asian (EAS) AF: 0.000129 AC: 5 AN: 38780

South Asian (SAS) AF: 0.000175 AC: 15 AN: 85558

European-Finnish (FIN) AF: 0.0000190 AC: 1 AN: 52578

Middle Eastern (MID) AF: 0.000350 AC: 2 AN: 5722

European-Non Finnish (NFE) AF: 0.000423 AC: 465 AN: 1098788

Other (OTH) AF: 0.000219 AC: 13 AN: 59466

GnomAD4 genome AF: 0.000365 AC: 53 AN: 145134 Hom.: 0 Cov.: 0 AF XY: 0.000298 AC XY: 21 AN XY: 70474

African (AFR) AF: 0.000155 AC: 6 AN: 38764

American (AMR) AF: 0.000288 AC: 4 AN: 13900

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3376

East Asian (EAS) AF: 0.000847 AC: 4 AN: 4722

South Asian (SAS) AF: 0.000226 AC: 1 AN: 4430

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10080

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 288

European-Non Finnish (NFE) AF: 0.000570 AC: 38 AN: 66702

Other (OTH) AF: 0.00 AC: 0 AN: 1984

Alfa AF: 0.00 Hom.: 123

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.1
Mutation Taster		=166/34	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs60216939; hg19: chr12-7045891;