12-6936728-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG
Variant summary
Our verdict is Benign. The variant received -12 ACMG points: 0P and 12B. BP6_Very_StrongBS2
The NM_001940.4(ATN1):c.1485_1508dupGCAGCAGCAGCAGCAGCAGCAGCA(p.Gln495_Gln502dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★). Synonymous variant affecting the same amino acid position (i.e. H503H) has been classified as Uncertain significance.
Frequency
Consequence
NM_001940.4 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- congenital hypotonia, epilepsy, developmental delay, and digital anomaliesInheritance: AD Classification: STRONG, MODERATE Submitted by: Illumina, Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P
- dentatorubral-pallidoluysian atrophyInheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Benign. The variant received -12 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001940.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ATN1 | NM_001940.4 | MANE Select | c.1485_1508dupGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln495_Gln502dup | disruptive_inframe_insertion | Exon 5 of 10 | NP_001931.2 | P54259 | |
| ATN1 | NM_001007026.2 | c.1485_1508dupGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln495_Gln502dup | disruptive_inframe_insertion | Exon 5 of 10 | NP_001007027.1 | P54259 | ||
| ATN1 | NM_001424176.1 | c.1485_1508dupGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln495_Gln502dup | disruptive_inframe_insertion | Exon 5 of 10 | NP_001411105.1 | P54259 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ATN1 | ENST00000396684.3 | TSL:1 MANE Select | c.1485_1508dupGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln495_Gln502dup | disruptive_inframe_insertion | Exon 5 of 10 | ENSP00000379915.2 | P54259 | |
| ATN1 | ENST00000356654.8 | TSL:1 | c.1485_1508dupGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln495_Gln502dup | disruptive_inframe_insertion | Exon 5 of 10 | ENSP00000349076.3 | P54259 | |
| ATN1 | ENST00000882240.1 | c.1485_1508dupGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln495_Gln502dup | disruptive_inframe_insertion | Exon 5 of 11 | ENSP00000552299.1 |
Frequencies
GnomAD3 genomes AF: 0.00163 AC: 236AN: 145034Hom.: 1 Cov.: 0 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000823 AC: 1184AN: 1438904Hom.: 0 Cov.: 0 AF XY: 0.000917 AC XY: 657AN XY: 716722 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome AF: 0.00163 AC: 236AN: 145134Hom.: 1 Cov.: 0 AF XY: 0.00143 AC XY: 101AN XY: 70474 show subpopulations
Age Distribution
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at