12-6936728-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

Variant names:

• chr12-6936728-A-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG
• rs60216939
• NM_001940.4:c.1476_1508dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Likely benign. The variant received -6 ACMG points: 0P and 6B. BP6_Moderate BS2

The NM_001940.4(ATN1):​c.1476_1508dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA​(p.Gln492_Gln502dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★). Synonymous variant affecting the same amino acid position (i.e. H503H) has been classified as Uncertain significance.

• Frequency:
  • Genomes: 𝑓 0.00018 (0 hom., cov: 0)
  • Exomes 𝑓: 0.000091 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: ATN1 NM_001940.4 disruptive_inframe_insertion
• Clinical Significance: Likely benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 0.621
• Publications: 8 publications found

Genes affected

ATN1 (HGNC:3033): (atrophin 1) Dentatorubral pallidoluysian atrophy (DRPLA) is a rare neurodegenerative disorder characterized by cerebellar ataxia, myoclonic epilepsy, choreoathetosis, and dementia. The disorder is related to the expansion from 7-35 copies to 49-93 copies of a trinucleotide repeat (CAG/CAA) within this gene. The encoded protein includes a serine repeat and a region of alternating acidic and basic amino acids, as well as the variable glutamine repeat. Alternative splicing results in two transcripts variants that encode the same protein. [provided by RefSeq, Jul 2016]

ATN1 Gene-Disease associations (from GenCC):

• congenital hypotonia, epilepsy, developmental delay, and digital anomalies

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: Illumina, Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P
• dentatorubral-pallidoluysian atrophy

  Inheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet

ACMG classification

Our verdict: Likely_benign. The variant received -6 ACMG points.

• BP6: Variant 12-6936728-A-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG is Benign according to our data. Variant chr12-6936728-A-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG is described in ClinVar as Likely_benign. ClinVar VariationId is 3910931.Status of the report is criteria_provided_single_submitter, 1 stars.
• BS2: High AC in GnomAd4 at 26 AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001940.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ATN1	NM_001940.4	MANE Select	c.1476_1508dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln492_Gln502dup	disruptive_inframe_insertion	Exon 5 of 10	NP_001931.2	P54259
	ATN1	NM_001007026.2		c.1476_1508dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln492_Gln502dup	disruptive_inframe_insertion	Exon 5 of 10	NP_001007027.1	P54259
	ATN1	NM_001424176.1		c.1476_1508dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln492_Gln502dup	disruptive_inframe_insertion	Exon 5 of 10	NP_001411105.1	P54259

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ATN1	ENST00000396684.3	TSL:1 MANE Select	c.1476_1508dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln492_Gln502dup	disruptive_inframe_insertion	Exon 5 of 10	ENSP00000379915.2	P54259
	ATN1	ENST00000356654.8	TSL:1	c.1476_1508dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln492_Gln502dup	disruptive_inframe_insertion	Exon 5 of 10	ENSP00000349076.3	P54259
	ATN1	ENST00000882240.1		c.1476_1508dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln492_Gln502dup	disruptive_inframe_insertion	Exon 5 of 11	ENSP00000552299.1

Frequencies

GnomAD3 genomes AF: 0.000179 AC: 26 AN: 145034 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.000129

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000720

Gnomad ASJ AF: 0.000296

Gnomad EAS AF: 0.000211

Gnomad SAS AF: 0.000677

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000225

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000910 AC: 131 AN: 1438902 Hom.: 0 Cov.: 0 AF XY: 0.0000991 AC XY: 71 AN XY: 716722

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 32226

American (AMR) AF: 0.0000499 AC: 2 AN: 40114

Ashkenazi Jewish (ASJ) AF: 0.000506 AC: 13 AN: 25680

East Asian (EAS) AF: 0.000490 AC: 19 AN: 38780

South Asian (SAS) AF: 0.000269 AC: 23 AN: 85556

European-Finnish (FIN) AF: 0.0000380 AC: 2 AN: 52578

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5722

European-Non Finnish (NFE) AF: 0.0000582 AC: 64 AN: 1098780

Other (OTH) AF: 0.000135 AC: 8 AN: 59466

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.000179 AC: 26 AN: 145134 Hom.: 0 Cov.: 0 AF XY: 0.000184 AC XY: 13 AN XY: 70474

African (AFR) AF: 0.000129 AC: 5 AN: 38764

American (AMR) AF: 0.0000719 AC: 1 AN: 13900

Ashkenazi Jewish (ASJ) AF: 0.000296 AC: 1 AN: 3376

East Asian (EAS) AF: 0.000212 AC: 1 AN: 4722

South Asian (SAS) AF: 0.000677 AC: 3 AN: 4430

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10080

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 288

European-Non Finnish (NFE) AF: 0.000225 AC: 15 AN: 66702

Other (OTH) AF: 0.00 AC: 0 AN: 1984

ClinVar

ClinVar submissions as Germline

Significance: Likely benign

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	-	1	not specified (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.62
Mutation Taster		=87/13	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs60216939; hg19: chr12-7045891;