13-110306953-GGCCCGGCTGTGCTCCTCGTGGAGCAGAAGGGCGGCGGGCAGCAGCAGCAGCCAGACGCTGAGCCGGGGCCCCATGGTGGCGCGCCCGAGGCGGCGAGGGACGGCT-G
Variant summary
Our verdict is Pathogenic. Variant got 14 ACMG points: 14P and 0B. PVS1PS1_ModeratePM2PP5_Moderate
The NM_001845.6(COL4A1):c.-31_74del(p.Met1_Ala25del) variant causes a start lost, conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).
Frequency
Consequence
NM_001845.6 start_lost, conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Pathogenic. Variant got 14 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
COL4A1 | NM_001845.6 | c.-31_74del | p.Met1_Ala25del | start_lost, conservative_inframe_deletion | Exon 1 of 52 | ENST00000375820.10 | NP_001836.3 | |
COL4A1 | NM_001845.6 | c.-31_74del | 5_prime_UTR_variant | Exon 1 of 52 | ENST00000375820.10 | NP_001836.3 | ||
COL4A2 | NM_001846.4 | c.-619_-515del | upstream_gene_variant | ENST00000360467.7 | NP_001837.2 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
COL4A1 | ENST00000375820.10 | c.-31_74del | p.Met1_Ala25del | start_lost, conservative_inframe_deletion | Exon 1 of 52 | 1 | NM_001845.6 | ENSP00000364979.4 | ||
COL4A1 | ENST00000375820.10 | c.-31_74del | 5_prime_UTR_variant | Exon 1 of 52 | 1 | NM_001845.6 | ENSP00000364979.4 | |||
COL4A2 | ENST00000360467.7 | c.-619_-515del | upstream_gene_variant | 5 | NM_001846.4 | ENSP00000353654.5 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 genome Cov.: 33
ClinVar
Submissions by phenotype
not provided Pathogenic:1
This sequence change affects the initiator methionine of the COL4A1 mRNA. The next in-frame methionine is located at codon 65. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with COL4A1-related conditions. This variant disrupts a region of the COL4A1 protein in which other variant(s) (p.Gly46Arg) have been determined to be pathogenic (Invitae). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
Publications
No publications associated with this variant yet.