13-52024351-CTCTGTAGTGAAGAATCAAAA-C
Variant summary
Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1PP5
The NM_001004127.3(ALG11):c.623_642delCTGTAGTGAAGAATCAAAAT(p.Ser208TyrfsTer4) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000274 in 1,461,846 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (no stars). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_001004127.3 frameshift
Scores
Clinical Significance
Conservation
Publications
- ALG11-congenital disorder of glycosylationInheritance: AR Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: G2P, ClinGen, Labcorp Genetics (formerly Invitae), Orphanet, Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 9 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001004127.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ALG11 | NM_001004127.3 | MANE Select | c.623_642delCTGTAGTGAAGAATCAAAAT | p.Ser208TyrfsTer4 | frameshift | Exon 3 of 4 | NP_001004127.2 | Q2TAA5 | |
| ALG11 | NR_036571.3 | n.66-3966_66-3947delCTGTAGTGAAGAATCAAAAT | intron | N/A |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ALG11 | ENST00000521508.2 | TSL:1 MANE Select | c.623_642delCTGTAGTGAAGAATCAAAAT | p.Ser208TyrfsTer4 | frameshift | Exon 3 of 4 | ENSP00000430236.1 | Q2TAA5 | |
| ALG11 | ENST00000649340.2 | c.623_642delCTGTAGTGAAGAATCAAAAT | p.Ser208TyrfsTer4 | frameshift | Exon 3 of 4 | ENSP00000497184.2 | A0A3B3IS90 | ||
| ALG11 | ENST00000681053.1 | c.392_411delCTGTAGTGAAGAATCAAAAT | p.Ser131TyrfsTer4 | frameshift | Exon 2 of 3 | ENSP00000505307.1 | A0A7P0T8Y4 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD2 exomes AF: 0.00000796 AC: 2AN: 251350 AF XY: 0.00 show subpopulations
GnomAD4 exome AF: 0.00000274 AC: 4AN: 1461846Hom.: 0 AF XY: 0.00000138 AC XY: 1AN XY: 727220 show subpopulations
Age Distribution
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at