rs387907180

Variant names:

• chr13-52024351-CTCTGTAGTGAAGAATCAAAA-C
• rs387907180
• NM_001004127.3:c.623_642delCTGTAGTGAAGAATCAAAAT

Variant summary

Our verdict is Pathogenic. Variant got 11 ACMG points: 11P and 0B. PVS1 PM2 PP5

The NM_001004127.3(ALG11):​c.623_642delCTGTAGTGAAGAATCAAAAT​(p.Ser208TyrfsTer4) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000274 in 1,461,846 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Likely pathogenic (no stars). Variant results in nonsense mediated mRNA decay.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000027 (0 hom.)
• Consequence: ALG11 NM_001004127.3 frameshift
• Clinical Significance: Pathogenic/Likely pathogenic no assertion criteria provided P:2
• Conservation: PhyloP100: 9.53

Genes affected

ALG11 (HGNC:32456): (ALG11 alpha-1,2-mannosyltransferase) This gene encodes a GDP-Man:Man3GlcNAc2-PP-dolichol-alpha1,2-mannosyltransferase which is localized to the cytosolic side of the endoplasmic reticulum (ER) and catalyzes the transfer of the fourth and fifth mannose residue from GDP-mannose (GDP-Man) to Man3GlcNAc2-PP-dolichol and Man4GlcNAc2-PP-dolichol resulting in the production of Man5GlcNAc2-PP-dolichol. Mutations in this gene are associated with congenital disorder of glycosylation type Ip (CDGIP). This gene overlaps but is distinct from the UTP14, U3 small nucleolar ribonucleoprotein, homolog C (yeast) gene. A pseudogene of the GDP-Man:Man3GlcNAc2-PP-dolichol-alpha1,2-mannosyltransferase has been identified on chromosome 19. [provided by RefSeq, Aug 2010]

ACMG classification

Verdict is Pathogenic. Variant got 11 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 13-52024351-CTCTGTAGTGAAGAATCAAAA-C is Pathogenic according to our data. Variant chr13-52024351-CTCTGTAGTGAAGAATCAAAA-C is described in ClinVar as [Likely_pathogenic]. Clinvar id is 31643.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ALG11	NM_001004127.3	c.623_642delCTGTAGTGAAGAATCAAAAT	p.Ser208TyrfsTer4	frameshift_variant	Exon 3 of 4	ENST00000521508.2	NP_001004127.2
ALG11	NR_036571.3	n.66-3966_66-3947delCTGTAGTGAAGAATCAAAAT		intron_variant	Intron 1 of 1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ALG11	ENST00000521508.2	c.623_642delCTGTAGTGAAGAATCAAAAT	p.Ser208TyrfsTer4	frameshift_variant	Exon 3 of 4	1	NM_001004127.3	ENSP00000430236.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD3 exomes AF: 0.00000796 AC: 2 AN: 251350 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 135846

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000176

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000274 AC: 4 AN: 1461846 Hom.: 0 AF XY: 0.00000138 AC XY: 1 AN XY: 727220

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000360

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:2

Revision: no assertion criteria provided

Submissions by phenotype

ALG11-congenital disorder of glycosylation Pathogenic:1

Mar 01, 2012

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

ALG11-related disorder Pathogenic:1

May 31, 2024

PreventionGenetics, part of Exact Sciences

Significance: Likely pathogenic

Review Status: no assertion criteria provided

Collection Method: clinical testing

The ALG11 c.623_642del20 variant is predicted to result in a frameshift and premature protein termination (p.Ser208Tyrfs*4). This variant was reported in the compound heterozygous state in an individual with congenital disorder of glycosylation 1p (Thiel et al 2012. PubMed ID: 22213132). This variant is reported in 0.0018% of alleles in individuals of European (Non-Finnish) descent in gnomAD. Frameshift variants in ALG11 are expected to be pathogenic. This variant is interpreted as likely pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs387907180; hg19: chr13-52598487;