13-70139383-ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG-ACTGCTGCTGCTGCTGCTG

Position:

• chr13-70139383-ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG-ACTGCTGCTGCTGCTGCTG

Variant summary

Our verdict is Benign. Variant got -8 ACMG points: 0P and 8B. BS1 BS2

The ENST00000414504.6(ATXN8OS):​n.1128_1148delTGCTGCTGCTGCTGCTGCTGC variant causes a splice region, non coding transcript exon change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00267 in 458,296 control chromosomes in the GnomAD database, including 13 homozygotes. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.0084 (12 hom., cov: 0)
  • Exomes 𝑓: 0.00088 (1 hom.)
• Consequence: ATXN8OS ENST00000414504.6 splice_region, non_coding_transcript_exon
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.190

Genes affected

ATXN8OS (HGNC:):

ACMG classification

Verdict is Benign. Variant got -8 ACMG points.

• BS1: Variant frequency is greater than expected in population afr. gnomad4 allele frequency = 0.0084 (917/109128) while in subpopulation AFR AF= 0.0311 (757/24352). AF 95% confidence interval is 0.0293. There are 12 homozygotes in gnomad4. There are 490 alleles in male gnomad4 subpopulation. Median coverage is 0. This position pass quality control queck.
• BS2: High Homozygotes in GnomAd4 at 12 gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
ATXN8OS	NR_002717.3	n.920_940delTGCTGCTGCTGCTGCTGCTGC		non_coding_transcript_exon_variant	5/5
ATXN8OS	NR_185834.1	n.454-7946_454-7926delTGCTGCTGCTGCTGCTGCTGC		intron_variant
ATXN8OS	NR_185835.1	n.454-7946_454-7926delTGCTGCTGCTGCTGCTGCTGC		intron_variant

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
ATXN8OS	ENST00000414504.6	n.1128_1148delTGCTGCTGCTGCTGCTGCTGC		splice_region_variant, non_coding_transcript_exon_variant	5/5	5
ENSG00000288330	ENST00000673087.1	n.28_48delCAGCAGCAGCAGCAGCAGCAG		non_coding_transcript_exon_variant	1/1
ATXN8OS	ENST00000660386.1	n.451-7946_451-7926delTGCTGCTGCTGCTGCTGCTGC		intron_variant

Frequencies

GnomAD3 genomes AF: 0.00834 AC: 910 AN: 109098 Hom.: 11 Cov.: 0

Gnomad AFR AF: 0.0309

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00958

Gnomad ASJ AF: 0.00281

Gnomad EAS AF: 0.000267

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.000153

Gnomad MID AF: 0.00391

Gnomad NFE AF: 0.000585

Gnomad OTH AF: 0.00852

GnomAD4 exome AF: 0.000876 AC: 306 AN: 349168 Hom.: 1 AF XY: 0.000816 AC XY: 152 AN XY: 186184

Gnomad4 AFR exome AF: 0.0177

Gnomad4 AMR exome AF: 0.00161

Gnomad4 ASJ exome AF: 0.00134

Gnomad4 EAS exome AF: 0.0000403

Gnomad4 SAS exome AF: 0.0000371

Gnomad4 FIN exome AF: 0.0000942

Gnomad4 NFE exome AF: 0.000333

Gnomad4 OTH exome AF: 0.00206

GnomAD4 genome AF: 0.00840 AC: 917 AN: 109128 Hom.: 12 Cov.: 0 AF XY: 0.00931 AC XY: 490 AN XY: 52656

Gnomad4 AFR AF: 0.0311

Gnomad4 AMR AF: 0.00957

Gnomad4 ASJ AF: 0.00281

Gnomad4 EAS AF: 0.000268

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.000153

Gnomad4 NFE AF: 0.000585

Gnomad4 OTH AF: 0.00847

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs193922930; hg19: chr13-70713515;