13-70139383-ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG-ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG

Position:

• chr13-70139383-ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG-ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG

Variant summary

Our verdict is Likely benign. Variant got -4 ACMG points: 0P and 4B. BS2

The NR_002717.2(ATXN8OS):​n.1131_1148dup variant causes a non coding transcript exon change involving the alteration of a non-conserved nucleotide. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.0018 (0 hom., cov: 0)
  • Exomes 𝑓: 0.0019 (81 hom.)
• Consequence: ATXN8OS NR_002717.2 non_coding_transcript_exon
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: -1.36

Genes affected

(HGNC:):

ATXN8OS (HGNC:10561): (ATXN8 opposite strand lncRNA) This gene is an antisense transcript to the KLHL1 gene (homolog to the Drosophila KELCH gene); it does not itself appear to be protein coding. A TAC/TGC trinucleotide repeat expansion that is incorporated into this gene transcript, but not the KLHL1 transcript, causes spinocerebellar ataxia type 8. Presumably the expansion interferes with normal antisense function of this transcript. [provided by RefSeq, Oct 2008]

ACMG classification

Verdict is Likely_benign. Variant got -4 ACMG points.

• BS2: High AC in GnomAd4 at 197 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
ATXN8OS	NR_002717.2	n.1131_1148dup		non_coding_transcript_exon_variant	5/5

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
	ENST00000673087.1	n.48_49insCAGCAGCAGCAGCAGCAG		non_coding_transcript_exon_variant	1/1
ATXN8OS	ENST00000678624.1	n.500-7943_500-7926dup		intron_variant, non_coding_transcript_variant

Frequencies

GnomAD3 genomes AF: 0.00181 AC: 197 AN: 109102 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.00523

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000821

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00240

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00123

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000750

Gnomad OTH AF: 0.00213

GnomAD4 exome AF: 0.00186 AC: 651 AN: 349120 Hom.: 81 Cov.: 0 AF XY: 0.00170 AC XY: 317 AN XY: 186142

Gnomad4 AFR exome AF: 0.00734

Gnomad4 AMR exome AF: 0.000963

Gnomad4 ASJ exome AF: 0.000167

Gnomad4 EAS exome AF: 0.00577

Gnomad4 SAS exome AF: 0.00111

Gnomad4 FIN exome AF: 0.00127

Gnomad4 NFE exome AF: 0.00154

Gnomad4 OTH exome AF: 0.00201

GnomAD4 genome AF: 0.00181 AC: 197 AN: 109132 Hom.: 0 Cov.: 0 AF XY: 0.00169 AC XY: 89 AN XY: 52662

Gnomad4 AFR AF: 0.00521

Gnomad4 AMR AF: 0.000820

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00241

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00123

Gnomad4 NFE AF: 0.000750

Gnomad4 OTH AF: 0.00212

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs193922930; hg19: chr13-70713515;