13-70139383-ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG-ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG

Position:

• chr13-70139383-ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG-ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG

Variant summary

Our verdict is Likely benign. Variant got -4 ACMG points: 0P and 4B. BS2

The NR_002717.3(ATXN8OS):​n.914_940dupTGCTGCTGCTGCTGCTGCTGCTGCTGC variant causes a non coding transcript exon change involving the alteration of a non-conserved nucleotide. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.00064 (2 hom., cov: 0)
  • Exomes 𝑓: 0.00030 (3 hom.)
  • Failed GnomAD Quality Control
• Consequence: ATXN8OS NR_002717.3 non_coding_transcript_exon
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: -1.36

Genes affected

ENSG00000288330 (HGNC:32925):

ATXN8OS (HGNC:10561): (ATXN8 opposite strand lncRNA) This gene is an antisense transcript to the KLHL1 gene (homolog to the Drosophila KELCH gene); it does not itself appear to be protein coding. A TAC/TGC trinucleotide repeat expansion that is incorporated into this gene transcript, but not the KLHL1 transcript, causes spinocerebellar ataxia type 8. Presumably the expansion interferes with normal antisense function of this transcript. [provided by RefSeq, Oct 2008]

ACMG classification

Verdict is Likely_benign. Variant got -4 ACMG points.

• BS2: High AC in GnomAd4 at 70 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
ATXN8OS	NR_002717.3	n.914_940dupTGCTGCTGCTGCTGCTGCTGCTGCTGC		non_coding_transcript_exon_variant	5/5
ATXN8OS	NR_185834.1	n.454-7952_454-7926dupTGCTGCTGCTGCTGCTGCTGCTGCTGC		intron_variant
ATXN8OS	NR_185835.1	n.454-7952_454-7926dupTGCTGCTGCTGCTGCTGCTGCTGCTGC		intron_variant

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
ENSG00000288330	ENST00000673087.1	n.22_48dupCAGCAGCAGCAGCAGCAGCAGCAGCAG		non_coding_transcript_exon_variant	1/1
ATXN8OS	ENST00000660386.1	n.451-7952_451-7926dupTGCTGCTGCTGCTGCTGCTGCTGCTGC		intron_variant
ATXN8OS	ENST00000677785.1	n.393-7952_393-7926dupTGCTGCTGCTGCTGCTGCTGCTGCTGC		intron_variant
ATXN8OS	ENST00000678624.1	n.500-7952_500-7926dupTGCTGCTGCTGCTGCTGCTGCTGCTGC		intron_variant

Frequencies

GnomAD3 genomes AF: 0.000642 AC: 70 AN: 109108 Hom.: 2 Cov.: 0

Gnomad AFR AF: 0.000617

Gnomad AMI AF: 0.0470

Gnomad AMR AF: 0.000274

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00133

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.000153

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000183

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000298 AC: 104 AN: 349190 Hom.: 3 Cov.: 0 AF XY: 0.000301 AC XY: 56 AN XY: 186194

Gnomad4 AFR exome AF: 0.000632

Gnomad4 AMR exome AF: 0.000214

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00141

Gnomad4 SAS exome AF: 0.000371

Gnomad4 FIN exome AF: 0.000236

Gnomad4 NFE exome AF: 0.000180

Gnomad4 OTH exome AF: 0.000302

GnomAD4 genome AF: 0.000641 AC: 70 AN: 109138 Hom.: 2 Cov.: 0 AF XY: 0.000646 AC XY: 34 AN XY: 52662

Gnomad4 AFR AF: 0.000616

Gnomad4 AMR AF: 0.000273

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00134

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.000153

Gnomad4 NFE AF: 0.000183

Gnomad4 OTH AF: 0.00

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs193922930; hg19: chr13-70713515;