13-70139383-ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG-ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG

Position:

• chr13-70139383-ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG-ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG

Variant summary

Our verdict is Likely benign. Variant got -4 ACMG points: 0P and 4B. BS2

The NR_002717.2(ATXN8OS):​n.1119_1148dup variant causes a non coding transcript exon change involving the alteration of a non-conserved nucleotide. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.00023 (0 hom., cov: 0)
  • Exomes 𝑓: 0.00022 (4 hom.)
  • Failed GnomAD Quality Control
• Consequence: ATXN8OS NR_002717.2 non_coding_transcript_exon
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: -1.36

Genes affected

(HGNC:):

ATXN8OS (HGNC:10561): (ATXN8 opposite strand lncRNA) This gene is an antisense transcript to the KLHL1 gene (homolog to the Drosophila KELCH gene); it does not itself appear to be protein coding. A TAC/TGC trinucleotide repeat expansion that is incorporated into this gene transcript, but not the KLHL1 transcript, causes spinocerebellar ataxia type 8. Presumably the expansion interferes with normal antisense function of this transcript. [provided by RefSeq, Oct 2008]

ACMG classification

Verdict is Likely_benign. Variant got -4 ACMG points.

• BS2: High AC in GnomAd4 at 25 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
ATXN8OS	NR_002717.2	n.1119_1148dup		non_coding_transcript_exon_variant	5/5

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
	ENST00000673087.1	n.48_49insCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG		non_coding_transcript_exon_variant	1/1
ATXN8OS	ENST00000678624.1	n.500-7955_500-7926dup		intron_variant, non_coding_transcript_variant

Frequencies

GnomAD3 genomes AF: 0.000229 AC: 25 AN: 109112 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.000288

Gnomad AMI AF: 0.00781

Gnomad AMR AF: 0.0000912

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00107

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000128

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000218 AC: 76 AN: 349188 Hom.: 4 Cov.: 0 AF XY: 0.000220 AC XY: 41 AN XY: 186184

Gnomad4 AFR exome AF: 0.000759

Gnomad4 AMR exome AF: 0.000267

Gnomad4 ASJ exome AF: 0.0000835

Gnomad4 EAS exome AF: 0.000887

Gnomad4 SAS exome AF: 0.000148

Gnomad4 FIN exome AF: 0.000283

Gnomad4 NFE exome AF: 0.000130

Gnomad4 OTH exome AF: 0.000201

GnomAD4 genome AF: 0.000229 AC: 25 AN: 109142 Hom.: 0 Cov.: 0 AF XY: 0.000228 AC XY: 12 AN XY: 52664

Gnomad4 AFR AF: 0.000287

Gnomad4 AMR AF: 0.0000911

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00107

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.000128

Gnomad4 OTH AF: 0.00

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs193922930; hg19: chr13-70713515;