13-70139383-ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG-ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG
Variant summary
Our verdict is Likely benign. The variant received -4 ACMG points: 0P and 4B. BS2
The NR_002717.3(ATXN8OS):n.911_940dupTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC variant causes a non coding transcript exon change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NR_002717.3 non_coding_transcript_exon
Scores
Clinical Significance
Conservation
Publications
- spinocerebellar ataxia type 8Inheritance: AD Classification: MODERATE Submitted by: Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -4 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NR_002717.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ATXN8OS | n.911_940dupTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC | non_coding_transcript_exon | Exon 5 of 5 | ||||||
| ATXN8OS | n.454-7955_454-7926dupTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC | intron | N/A | ||||||
| ATXN8OS | n.454-7955_454-7926dupTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC | intron | N/A |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ATXN8 | n.19_48dupCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG | non_coding_transcript_exon | Exon 1 of 1 | ||||||
| ATXN8OS | n.784_813dupTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC | non_coding_transcript_exon | Exon 5 of 5 | ||||||
| ATXN8OS | n.451-7955_451-7926dupTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC | intron | N/A |
Frequencies
GnomAD3 genomes AF: 0.000229 AC: 25AN: 109112Hom.: 0 Cov.: 0 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000218 AC: 76AN: 349188Hom.: 4 Cov.: 0 AF XY: 0.000220 AC XY: 41AN XY: 186184 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.000229 AC: 25AN: 109142Hom.: 0 Cov.: 0 AF XY: 0.000228 AC XY: 12AN XY: 52664 show subpopulations
Age Distribution
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.