13-70139383-ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG-ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG
Variant summary
Our verdict is Likely benign. The variant received -4 ACMG points: 0P and 4B. BS2
The NR_002717.3(ATXN8OS):n.908_940dupTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC variant causes a non coding transcript exon change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NR_002717.3 non_coding_transcript_exon
Scores
Clinical Significance
Conservation
Publications
- spinocerebellar ataxia type 8Inheritance: AD Classification: MODERATE Submitted by: Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -4 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NR_002717.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ATXN8OS | n.908_940dupTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC | non_coding_transcript_exon | Exon 5 of 5 | ||||||
| ATXN8OS | n.454-7958_454-7926dupTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC | intron | N/A | ||||||
| ATXN8OS | n.454-7958_454-7926dupTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC | intron | N/A |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ATXN8 | n.16_48dupCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG | non_coding_transcript_exon | Exon 1 of 1 | ||||||
| ATXN8OS | n.781_813dupTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC | non_coding_transcript_exon | Exon 5 of 5 | ||||||
| ATXN8OS | n.451-7958_451-7926dupTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC | intron | N/A |
Frequencies
GnomAD3 genomes AF: 0.000238 AC: 26AN: 109116Hom.: 0 Cov.: 0 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000172 AC: 60AN: 349196Hom.: 0 Cov.: 0 AF XY: 0.000150 AC XY: 28AN XY: 186194 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome AF: 0.000238 AC: 26AN: 109146Hom.: 0 Cov.: 0 AF XY: 0.000323 AC XY: 17AN XY: 52666 show subpopulations
Age Distribution
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at