13-70139383-ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG-ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG

Variant names:

• chr13-70139383-A-ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG
• rs193922930
• ENST00000673087.1:n.7_48dupCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The ENST00000673087.1(ENSG00000288330):​n.7_48dupCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG variant causes a non coding transcript exon change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.000027 (0 hom., cov: 0)
  • Exomes 𝑓: 0.000063 (1 hom.)
  • Failed GnomAD Quality Control
• Consequence: ENSG00000288330 ENST00000673087.1 non_coding_transcript_exon
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: -1.36
• Publications: 0 publications found

Genes affected

ENSG00000288330 (HGNC:32925):

ATXN8OS (HGNC:10561): (ATXN8 opposite strand lncRNA) This gene is an antisense transcript to the KLHL1 gene (homolog to the Drosophila KELCH gene); it does not itself appear to be protein coding. A TAC/TGC trinucleotide repeat expansion that is incorporated into this gene transcript, but not the KLHL1 transcript, causes spinocerebellar ataxia type 8. Presumably the expansion interferes with normal antisense function of this transcript. [provided by RefSeq, Oct 2008]

ATXN8OS Gene-Disease associations (from GenCC):

• spinocerebellar ataxia type 8

  Inheritance: AD Classification: MODERATE Submitted by: Ambry Genetics

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000673087.1. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ATXN8OS	NR_002717.3		n.899_940dupTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC		non_coding_transcript_exon	Exon 5 of 5
	ATXN8OS	NR_185834.1		n.454-7967_454-7926dupTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC		intron	N/A
	ATXN8OS	NR_185835.1		n.454-7967_454-7926dupTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC		intron	N/A

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ENSG00000288330	ENST00000673087.1		n.7_48dupCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG		non_coding_transcript_exon	Exon 1 of 1
	ATXN8OS	ENST00000756272.1		n.772_813dupTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC		non_coding_transcript_exon	Exon 5 of 5
	ATXN8OS	ENST00000660386.1		n.451-7967_451-7926dupTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC		intron	N/A

Frequencies

GnomAD3 genomes AF: 0.0000275 AC: 3 AN: 109116 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.0000411

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.000351

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000183

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000630 AC: 22 AN: 349206 Hom.: 1 Cov.: 0 AF XY: 0.0000752 AC XY: 14 AN XY: 186204

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 7908

American (AMR) AF: 0.0000535 AC: 1 AN: 18694

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 11978

East Asian (EAS) AF: 0.000323 AC: 8 AN: 24794

South Asian (SAS) AF: 0.0000742 AC: 2 AN: 26972

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 21224

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 1578

European-Non Finnish (NFE) AF: 0.0000509 AC: 11 AN: 216158

Other (OTH) AF: 0.00 AC: 0 AN: 19900

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.000171996), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.0000275 AC: 3 AN: 109116 Hom.: 0 Cov.: 0 AF XY: 0.0000380 AC XY: 2 AN XY: 52594

African (AFR) AF: 0.0000411 AC: 1 AN: 24304

American (AMR) AF: 0.00 AC: 0 AN: 10960

Ashkenazi Jewish (ASJ) AF: 0.000351 AC: 1 AN: 2848

East Asian (EAS) AF: 0.00 AC: 0 AN: 3746

South Asian (SAS) AF: 0.00 AC: 0 AN: 3620

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 6518

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 256

European-Non Finnish (NFE) AF: 0.0000183 AC: 1 AN: 54686

Other (OTH) AF: 0.00 AC: 0 AN: 1408

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		-1.4

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs193922930; hg19: chr13-70713515;