13-99985448-AGCGGCGGCGGCAGCGGCGGCGGCGGCTGCGGCGGCG-AGCGGCG

Variant names:

• chr13-99985448-AGCGGCGGCGGCAGCGGCGGCGGCGGCTGCG-A
• rs756225250
• NM_007129.5:c.1377_1406delAGCGGCGGCGGCGGCTGCGGCGGCGGCGGC

Variant summary

Our verdict is Likely benign. The variant received -5 ACMG points: 0P and 5B. BP3 BS2

The NM_007129.5(ZIC2):​c.1377_1406delAGCGGCGGCGGCGGCTGCGGCGGCGGCGGC​(p.Ala460_Ala469del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.0000783 in 1,417,518 control chromosomes in the GnomAD database, including 1 homozygotes. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. A459A) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.000060 (0 hom., cov: 32)
  • Exomes 𝑓: 0.000081 (1 hom.)
• Consequence: ZIC2 NM_007129.5 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:2
• Conservation: PhyloP100: 5.22

Genes affected

ZIC2 (HGNC:12873): (Zic family member 2) This gene encodes a member of the ZIC family of C2H2-type zinc finger proteins. This protein functions as a transcriptional repressor and may regulate tissue specific expression of dopamine receptor D1. Expansion of an alanine repeat in the C-terminus of the encoded protein and other mutations in this gene cause holoprosencephaly type 5. Holoprosencephaly is the most common structural anomaly of the human brain. A polyhistidine tract polymorphism in this gene may be associated with increased risk of neural tube defects. This gene is closely linked to a gene encoding zinc finger protein of the cerebellum 5, a related family member on chromosome 13. [provided by RefSeq, Jul 2016]

ACMG classification

Our verdict: Likely_benign. The variant received -5 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_007129.5
• BS2: High AC in GnomAd4 at 9 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ZIC2	NM_007129.5	c.1377_1406delAGCGGCGGCGGCGGCTGCGGCGGCGGCGGC	p.Ala460_Ala469del	disruptive_inframe_deletion	Exon 3 of 3	ENST00000376335.8	NP_009060.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ZIC2	ENST00000376335.8	c.1377_1406delAGCGGCGGCGGCGGCTGCGGCGGCGGCGGC	p.Ala460_Ala469del	disruptive_inframe_deletion	Exon 3 of 3	1	NM_007129.5	ENSP00000365514.3

Frequencies

GnomAD3 genomes AF: 0.0000596 AC: 9 AN: 150892 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.0000971

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000739

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.0000226 AC: 3 AN: 132790 AF XY: 0.0000128

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000433

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.0000805 AC: 102 AN: 1266626 Hom.: 1 AF XY: 0.0000945 AC XY: 59 AN XY: 624118

Gnomad4 AFR exome AF: 0.00 AC: 0 AN: 26410

Gnomad4 AMR exome AF: 0.00 AC: 0 AN: 23502

Gnomad4 ASJ exome AF: 0.00 AC: 0 AN: 20732

Gnomad4 EAS exome AF: 0.00 AC: 0 AN: 31232

Gnomad4 SAS exome AF: 0.0000390 AC: 2 AN: 51338

Gnomad4 FIN exome AF: 0.00 AC: 0 AN: 30162

Gnomad4 NFE exome AF: 0.0000925 AC: 95 AN: 1026472

Gnomad4 Remaining exome AF: 0.0000966 AC: 5 AN: 51774

GnomAD4 genome AF: 0.0000596 AC: 9 AN: 150892 Hom.: 0 Cov.: 32 AF XY: 0.0000815 AC XY: 6 AN XY: 73636

Gnomad4 AFR AF: 0.0000971 AC: 0.0000970685 AN: 0.0000970685

Gnomad4 AMR AF: 0.00 AC: 0 AN: 0

Gnomad4 ASJ AF: 0.00 AC: 0 AN: 0

Gnomad4 EAS AF: 0.00 AC: 0 AN: 0

Gnomad4 SAS AF: 0.00 AC: 0 AN: 0

Gnomad4 FIN AF: 0.00 AC: 0 AN: 0

Gnomad4 NFE AF: 0.0000739 AC: 0.0000739098 AN: 0.0000739098

Gnomad4 OTH AF: 0.00 AC: 0 AN: 0

Alfa AF: 0.0000843 Hom.: 0

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Holoprosencephaly 5 Uncertain:2

Apr 01, 2023

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant has been observed in individuals with holoprosencephaly (PMID: 19177455, 21940735). This variant, c.1377_1406del, results in the deletion of 10 amino acid(s) of the ZIC2 protein (p.Ala461_Ala470del), but otherwise preserves the integrity of the reading frame. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate poor data quality at this position in the gnomAD database. ClinVar contains an entry for this variant (Variation ID: 1343256). This variant disrupts a region of the ZIC2 protein in which other variant(s) (p.Ala461_465del) have been observed in individuals with ZIC2-related conditions (PMID: 19955556). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Jan 14, 2022

Institute of Human Genetics, Clinical Exome/Genome Diagnostics Group, University Hospital Bonn

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
Mutation Taster		=131/69	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs756225250; hg19: chr13-100637702;