rs756225250

Variant names:

• chr13-99985448-AGCGGCGGCGGCAGCGGCGGCGGCGGCTGCGGCGGCG-A
• rs756225250
• NM_007129.5:c.1371_1406delGGCGGCAGCGGCGGCGGCGGCTGCGGCGGCGGCGGC

Your query was ambiguous. Multiple possible variants found:

• chr13-99985448-AGCGGCGGCGGCAGCGGCGGCGGCGGCTGCGGCGGCG-A
• chr13-99985448-AGCGGCGGCGGCAGCGGCGGCGGCGGCTGCGGCGGCG-AGCG
• chr13-99985448-AGCGGCGGCGGCAGCGGCGGCGGCGGCTGCGGCGGCG-AGCGGCG
• chr13-99985448-AGCGGCGGCGGCAGCGGCGGCGGCGGCTGCGGCGGCG-AGCGGCGGCGGCAGCGGCGGCGGCGGCTGCGGCGGCGGCGGCAGCGGCGGCGGCGGCTGCGGCGGCG

Variant summary

Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3

The NM_007129.5(ZIC2):​c.1371_1406delGGCGGCAGCGGCGGCGGCGGCTGCGGCGGCGGCGGC​(p.Ala458_Ala469del) variant causes a disruptive inframe deletion change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: ZIC2 NM_007129.5 disruptive_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 5.22
• Publications: 0 publications found

Genes affected

ZIC2 (HGNC:12873): (Zic family member 2) This gene encodes a member of the ZIC family of C2H2-type zinc finger proteins. This protein functions as a transcriptional repressor and may regulate tissue specific expression of dopamine receptor D1. Expansion of an alanine repeat in the C-terminus of the encoded protein and other mutations in this gene cause holoprosencephaly type 5. Holoprosencephaly is the most common structural anomaly of the human brain. A polyhistidine tract polymorphism in this gene may be associated with increased risk of neural tube defects. This gene is closely linked to a gene encoding zinc finger protein of the cerebellum 5, a related family member on chromosome 13. [provided by RefSeq, Jul 2016]

ZIC2 Gene-Disease associations (from GenCC):

• holoprosencephaly 5

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), G2P, Genomics England PanelApp
• holoprosencephaly

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_benign. The variant received -1 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_007129.5

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ZIC2	NM_007129.5	c.1371_1406delGGCGGCAGCGGCGGCGGCGGCTGCGGCGGCGGCGGC	p.Ala458_Ala469del	disruptive_inframe_deletion	Exon 3 of 3	ENST00000376335.8	NP_009060.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ZIC2	ENST00000376335.8	c.1371_1406delGGCGGCAGCGGCGGCGGCGGCTGCGGCGGCGGCGGC	p.Ala458_Ala469del	disruptive_inframe_deletion	Exon 3 of 3	1	NM_007129.5	ENSP00000365514.3

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Data not reliable, filtered out with message: AC0 AF: 0.00 AC: 0 AN: 1266630 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 624118

African (AFR) AF: 0.00 AC: 0 AN: 26410

American (AMR) AF: 0.00 AC: 0 AN: 23502

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 20732

East Asian (EAS) AF: 0.00 AC: 0 AN: 31232

South Asian (SAS) AF: 0.00 AC: 0 AN: 51340

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 30162

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5004

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 1026474

Other (OTH) AF: 0.00 AC: 0 AN: 51774

GnomAD4 genome Cov.: 32

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.00000378

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.2

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs756225250; hg19: chr13-100637702;