rs756225250

Positions:

• chr13-99985448-AGCGGCGGCGGCAGCGGCGGCGGCGGCTGCGGCGGCG-A
• chr13-99985448-AGCGGCGGCGGCAGCGGCGGCGGCGGCTGCGGCGGCG-AGCG
• chr13-99985448-AGCGGCGGCGGCAGCGGCGGCGGCGGCTGCGGCGGCG-AGCGGCG
• chr13-99985448-AGCGGCGGCGGCAGCGGCGGCGGCGGCTGCGGCGGCG-AGCGGCGGCGGCAGCGGCGGCGGCGGCTGCGGCGGCGGCGGCAGCGGCGGCGGCGGCTGCGGCGGCG

Variant summary

Our verdict is Uncertain significance. Variant got 1 ACMG points: 2P and 1B. PM2 BP3

The NM_007129.5(ZIC2):​c.1371_1406del​(p.Ala459_Ala470del) variant causes a inframe deletion change. The variant was absent in control chromosomes in GnomAD project. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: ZIC2 NM_007129.5 inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 5.22

Genes affected

ZIC2 (HGNC:12873): (Zic family member 2) This gene encodes a member of the ZIC family of C2H2-type zinc finger proteins. This protein functions as a transcriptional repressor and may regulate tissue specific expression of dopamine receptor D1. Expansion of an alanine repeat in the C-terminus of the encoded protein and other mutations in this gene cause holoprosencephaly type 5. Holoprosencephaly is the most common structural anomaly of the human brain. A polyhistidine tract polymorphism in this gene may be associated with increased risk of neural tube defects. This gene is closely linked to a gene encoding zinc finger protein of the cerebellum 5, a related family member on chromosome 13. [provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Uncertain_significance. Variant got 1 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• BP3: Nonframeshift variant in repetitive region in NM_007129.5

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
ZIC2	NM_007129.5	c.1371_1406del	p.Ala459_Ala470del	inframe_deletion	3/3	ENST00000376335.8

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
ZIC2	ENST00000376335.8	c.1371_1406del	p.Ala459_Ala470del	inframe_deletion	3/3	1	NM_007129.5	P1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Data not reliable, filtered out with message: AC0 AF: 0.00 AC: 0 AN: 1266630 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 624118

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 32

Bravo AF: 0.00000378

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs756225250; hg19: chr13-100637702;