13-99985448-AGCGGCGGCGGCAGCGGCGGCGGCGGCTGCGGCGGCG-AGCGGCGGCGGCAGCGGCGGCGGCGGCTGCGGCGGCGGCGGCAGCGGCGGCGGCGGCTGCGGCGGCG

Variant names:

• chr13-99985448-A-AGCGGCGGCGGCAGCGGCGGCGGCGGCTGCG
• rs756225250
• NM_007129.5:c.1377_1406dupAGCGGCGGCGGCGGCTGCGGCGGCGGCGGC

Variant summary

Our verdict is Likely pathogenic. Variant got 9 ACMG points: 10P and 1B. PM2 PP5_Very_Strong BP3

The NM_007129.5(ZIC2):​c.1377_1406dupAGCGGCGGCGGCGGCTGCGGCGGCGGCGGC​(p.Ala460_Ala469dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: ZIC2 NM_007129.5 disruptive_inframe_insertion
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:3
• Conservation: PhyloP100: 1.50

Genes affected

ZIC2 (HGNC:12873): (Zic family member 2) This gene encodes a member of the ZIC family of C2H2-type zinc finger proteins. This protein functions as a transcriptional repressor and may regulate tissue specific expression of dopamine receptor D1. Expansion of an alanine repeat in the C-terminus of the encoded protein and other mutations in this gene cause holoprosencephaly type 5. Holoprosencephaly is the most common structural anomaly of the human brain. A polyhistidine tract polymorphism in this gene may be associated with increased risk of neural tube defects. This gene is closely linked to a gene encoding zinc finger protein of the cerebellum 5, a related family member on chromosome 13. [provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Likely_pathogenic. Variant got 9 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 13-99985448-A-AGCGGCGGCGGCAGCGGCGGCGGCGGCTGCG is Pathogenic according to our data. Variant chr13-99985448-A-AGCGGCGGCGGCAGCGGCGGCGGCGGCTGCG is described in ClinVar as [Pathogenic]. Clinvar id is 468365.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BP3: Nonframeshift variant in repetitive region in NM_007129.5

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ZIC2	NM_007129.5	c.1377_1406dupAGCGGCGGCGGCGGCTGCGGCGGCGGCGGC	p.Ala460_Ala469dup	disruptive_inframe_insertion	Exon 3 of 3	ENST00000376335.8	NP_009060.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ZIC2	ENST00000376335.8	c.1377_1406dupAGCGGCGGCGGCGGCTGCGGCGGCGGCGGC	p.Ala460_Ala469dup	disruptive_inframe_insertion	Exon 3 of 3	1	NM_007129.5	ENSP00000365514.3
ZIC2	ENST00000468291.1	n.351_380dupAGCGGCGGCGGCGGCTGCGGCGGCGGCGGC		splice_region_variant, non_coding_transcript_exon_variant	Exon 3 of 3	2
ZIC2	ENST00000490085.5	n.423_452dupAGCGGCGGCGGCGGCTGCGGCGGCGGCGGC		splice_region_variant, non_coding_transcript_exon_variant	Exon 3 of 3	3
ZIC2	ENST00000481565.1	n.-46_-45insGCGGCGGCGGCAGCGGCGGCGGCGGCTGCG		upstream_gene_variant		2

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 31

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Holoprosencephaly 5 Pathogenic:3

Mar 29, 2022

Baylor Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

May 03, 2022

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

For these reasons, this variant has been classified as Pathogenic. Experimental studies have shown that this variant affects ZIC2 function (PMID: 15590697). Algorithms developed to predict the effect of variants on protein structure and function are not available or were not evaluated for this variant. ClinVar contains an entry for this variant (Variation ID: 468365). This variant has been observed in individuals with holoprosencephaly (PMID: 9771712, 11285244, 19955556). It has also been observed to segregate with disease in related individuals. This variant is not present in population databases (gnomAD no frequency). This variant, c.1377_1406dup, results in the insertion of 10 amino acid(s) of the ZIC2 protein (p.Ala461_Ala470dup), but otherwise preserves the integrity of the reading frame. -

Mar 15, 2017

Muenke lab, National Institutes of Health

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs756225250; hg19: chr13-100637702;