13-99985460-AGCGGCGGCGGCGGCTGCGGCGGCGGCG-AGCGGCGGCGGCGGCTGCGGCGGCGGCGGCGGCGGCTGCGGCGGCGGCG

Variant names:

• chr13-99985460-A-AGCGGCGGCGGCGGCTGCGGCG
• rs761822481
• NM_007129.5:c.1386_1406dupGGCGGCTGCGGCGGCGGCGGC

Variant summary

Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3

The NM_007129.5(ZIC2):​c.1386_1406dupGGCGGCTGCGGCGGCGGCGGC​(p.Ala463_Ala469dup) variant causes a disruptive inframe insertion change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: ZIC2 NM_007129.5 disruptive_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 5.97
• Publications: 0 publications found

Genes affected

ZIC2 (HGNC:12873): (Zic family member 2) This gene encodes a member of the ZIC family of C2H2-type zinc finger proteins. This protein functions as a transcriptional repressor and may regulate tissue specific expression of dopamine receptor D1. Expansion of an alanine repeat in the C-terminus of the encoded protein and other mutations in this gene cause holoprosencephaly type 5. Holoprosencephaly is the most common structural anomaly of the human brain. A polyhistidine tract polymorphism in this gene may be associated with increased risk of neural tube defects. This gene is closely linked to a gene encoding zinc finger protein of the cerebellum 5, a related family member on chromosome 13. [provided by RefSeq, Jul 2016]

ZIC2 Gene-Disease associations (from GenCC):

• holoprosencephaly 5

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Ambry Genetics, G2P
• holoprosencephaly

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_benign. The variant received -1 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_007129.5

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_007129.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ZIC2	NM_007129.5	MANE Select	c.1386_1406dupGGCGGCTGCGGCGGCGGCGGC	p.Ala463_Ala469dup	disruptive_inframe_insertion	Exon 3 of 3	NP_009060.2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ZIC2	ENST00000376335.8	TSL:1 MANE Select	c.1386_1406dupGGCGGCTGCGGCGGCGGCGGC	p.Ala463_Ala469dup	disruptive_inframe_insertion	Exon 3 of 3	ENSP00000365514.3	O95409
	ZIC2	ENST00000468291.1	TSL:2	n.360_380dupGGCGGCTGCGGCGGCGGCGGC		splice_region non_coding_transcript_exon	Exon 3 of 3
	ZIC2	ENST00000490085.5	TSL:3	n.432_452dupGGCGGCTGCGGCGGCGGCGGC		splice_region non_coding_transcript_exon	Exon 3 of 3

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 31

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions as Germline

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	Holoprosencephaly 5 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		6.0

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs761822481; hg19: chr13-100637714;