rs761822481

Variant names:

• chr13-99985460-AGCGGCGGCGGCGGCTGCGGCGGCGGCG-A
• rs761822481
• NM_007129.5:c.1380_1406delGGCGGCGGCGGCTGCGGCGGCGGCGGC

Your query was ambiguous. Multiple possible variants found:

• chr13-99985460-AGCGGCGGCGGCGGCTGCGGCGGCGGCG-A
• chr13-99985460-AGCGGCGGCGGCGGCTGCGGCGGCGGCG-AGCG
• chr13-99985460-AGCGGCGGCGGCGGCTGCGGCGGCGGCG-AGCGGCG
• chr13-99985460-AGCGGCGGCGGCGGCTGCGGCGGCGGCG-AGCGGCGGCG
• chr13-99985460-AGCGGCGGCGGCGGCTGCGGCGGCGGCG-AGCGGCGGCGGCG
• chr13-99985460-AGCGGCGGCGGCGGCTGCGGCGGCGGCG-AGCGGCGGCGGCGGCTGCGGCGGCGGCGGCGGCGGCTGCGGCGGCGGCG
• chr13-99985460-AGCGGCGGCGGCGGCTGCGGCGGCGGCG-AGCGGCGGCGGCGGCTGCGGCGGCGGCGGCGGCTGCGGCGGCGGCG
• chr13-99985460-AGCGGCGGCGGCGGCTGCGGCGGCGGCG-AGCGGCGGCGGCGGCTGCGGCGGCGGCGGCTGCGGCGGCGGCG

Variant summary

Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3

The NM_007129.5(ZIC2):​c.1380_1406delGGCGGCGGCGGCTGCGGCGGCGGCGGC​(p.Ala461_Ala469del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.00000163 in 1,225,764 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. A460A) has been classified as Likely benign.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000016 (0 hom.)
• Consequence: ZIC2 NM_007129.5 disruptive_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 5.97
• Publications: 0 publications found

Genes affected

ZIC2 (HGNC:12873): (Zic family member 2) This gene encodes a member of the ZIC family of C2H2-type zinc finger proteins. This protein functions as a transcriptional repressor and may regulate tissue specific expression of dopamine receptor D1. Expansion of an alanine repeat in the C-terminus of the encoded protein and other mutations in this gene cause holoprosencephaly type 5. Holoprosencephaly is the most common structural anomaly of the human brain. A polyhistidine tract polymorphism in this gene may be associated with increased risk of neural tube defects. This gene is closely linked to a gene encoding zinc finger protein of the cerebellum 5, a related family member on chromosome 13. [provided by RefSeq, Jul 2016]

ZIC2 Gene-Disease associations (from GenCC):

• holoprosencephaly 5

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), G2P, Genomics England PanelApp
• holoprosencephaly

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_benign. The variant received -1 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_007129.5

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_007129.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ZIC2	NM_007129.5	MANE Select	c.1380_1406delGGCGGCGGCGGCTGCGGCGGCGGCGGC	p.Ala461_Ala469del	disruptive_inframe_deletion	Exon 3 of 3	NP_009060.2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ZIC2	ENST00000376335.8	TSL:1 MANE Select	c.1380_1406delGGCGGCGGCGGCTGCGGCGGCGGCGGC	p.Ala461_Ala469del	disruptive_inframe_deletion	Exon 3 of 3	ENSP00000365514.3
	ZIC2	ENST00000468291.1	TSL:2	n.354_380delGGCGGCGGCGGCTGCGGCGGCGGCGGC		non_coding_transcript_exon	Exon 3 of 3
	ZIC2	ENST00000477213.1	TSL:2	n.462_*15delGGCGGCGGCGGCTGCGGCGGCGGCGGC		splice_region non_coding_transcript_exon	Exon 2 of 2

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome AF: 0.00000163 AC: 2 AN: 1225764 Hom.: 0 AF XY: 0.00000166 AC XY: 1 AN XY: 600920

African (AFR) AF: 0.00 AC: 0 AN: 25248

American (AMR) AF: 0.00 AC: 0 AN: 18246

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 19342

East Asian (EAS) AF: 0.0000338 AC: 1 AN: 29576

South Asian (SAS) AF: 0.00 AC: 0 AN: 45862

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 27714

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 4760

European-Non Finnish (NFE) AF: 9.95e-7 AC: 1 AN: 1005136

Other (OTH) AF: 0.00 AC: 0 AN: 49880

GnomAD4 genome Cov.: 32

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		6.0

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs761822481; hg19: chr13-100637714;