14-102592949-GGCCGCCTCCGCCTCCGCCGCC-G

Position:

• chr14-102592949-GGCCGCCTCCGCCTCCGCCGCC-G

Variant summary

Our verdict is Likely benign. Variant got -6 ACMG points: 0P and 6B. BP6_Moderate BS2

The NM_015156.4(RCOR1):​c.76_96delTCCGCCGCCGCCGCCTCCGCC​(p.Ser26_Ala32del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00298 in 1,200,702 control chromosomes in the GnomAD database, including 10 homozygotes. Variant has been reported in ClinVar as Likely benign (★).

• Frequency:
  • Genomes: 𝑓 0.0023 (1 hom., cov: 32)
  • Exomes 𝑓: 0.0031 (9 hom.)
• Consequence: RCOR1 NM_015156.4 conservative_inframe_deletion
• Clinical Significance: Likely benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 3.11

Genes affected

RCOR1 (HGNC:17441): (REST corepressor 1) This gene encodes a protein that is well-conserved, downregulated at birth, and with a specific role in determining neural cell differentiation. The encoded protein binds to the C-terminal domain of REST (repressor element-1 silencing transcription factor). [provided by RefSeq, Aug 2011]

ACMG classification

Verdict is Likely_benign. Variant got -6 ACMG points.

• BP6: Variant 14-102592949-GGCCGCCTCCGCCTCCGCCGCC-G is Benign according to our data. Variant chr14-102592949-GGCCGCCTCCGCCTCCGCCGCC-G is described in ClinVar as [Likely_benign]. Clinvar id is 1643092.Status of the report is criteria_provided_single_submitter, 1 stars.
• BS2: High AC in GnomAd4 at 336 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
RCOR1	NM_015156.4	c.76_96delTCCGCCGCCGCCGCCTCCGCC	p.Ser26_Ala32del	conservative_inframe_deletion	1/12	ENST00000262241.7	NP_055971.2
RCOR1	XM_047431148.1	c.76_96delTCCGCCGCCGCCGCCTCCGCC	p.Ser26_Ala32del	conservative_inframe_deletion	1/10		XP_047287104.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
RCOR1	ENST00000262241.7	c.76_96delTCCGCCGCCGCCGCCTCCGCC	p.Ser26_Ala32del	conservative_inframe_deletion	1/12	1	NM_015156.4	ENSP00000262241.5

Frequencies

GnomAD3 genomes AF: 0.00227 AC: 337 AN: 148656 Hom.: 1 Cov.: 32

Gnomad AFR AF: 0.00105

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00120

Gnomad ASJ AF: 0.00293

Gnomad EAS AF: 0.000195

Gnomad SAS AF: 0.000627

Gnomad FIN AF: 0.000638

Gnomad MID AF: 0.00327

Gnomad NFE AF: 0.00375

Gnomad OTH AF: 0.00245

GnomAD3 exomes AF: 0.00180 AC: 60 AN: 33384 Hom.: 0 AF XY: 0.00189 AC XY: 39 AN XY: 20610

Gnomad AFR exome AF: 0.00249

Gnomad AMR exome AF: 0.00281

Gnomad ASJ exome AF: 0.00282

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.000962

Gnomad FIN exome AF: 0.00100

Gnomad NFE exome AF: 0.00213

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00308 AC: 3242 AN: 1051938 Hom.: 9 AF XY: 0.00309 AC XY: 1574 AN XY: 509578

Gnomad4 AFR exome AF: 0.000927

Gnomad4 AMR exome AF: 0.00221

Gnomad4 ASJ exome AF: 0.00313

Gnomad4 EAS exome AF: 0.000239

Gnomad4 SAS exome AF: 0.000885

Gnomad4 FIN exome AF: 0.00158

Gnomad4 NFE exome AF: 0.00333

Gnomad4 OTH exome AF: 0.00260

GnomAD4 genome AF: 0.00226 AC: 336 AN: 148764 Hom.: 1 Cov.: 32 AF XY: 0.00174 AC XY: 126 AN XY: 72564

Gnomad4 AFR AF: 0.00105

Gnomad4 AMR AF: 0.00120

Gnomad4 ASJ AF: 0.00293

Gnomad4 EAS AF: 0.000195

Gnomad4 SAS AF: 0.000627

Gnomad4 FIN AF: 0.000638

Gnomad4 NFE AF: 0.00375

Gnomad4 OTH AF: 0.00194

Alfa AF: 0.00178 Hom.: 0

ClinVar

Significance: Likely benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Benign:1

Likely benign, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Jan 22, 2024

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs754925733; hg19: chr14-103059286;