14-28767450-CCCGCCGCCGCCCGCCCCGCAACCG-CCCGCCGCCGCCCGCCCCGCAACCGCCGCCGCCGCCCGCCCCGCAACCG

Variant names:

• chr14-28767450-C-CCCGCCGCCGCCCGCCCCGCAACCG
• rs587783632
• NM_005249.5:c.183_206dupCGCCCCGCAACCGCCGCCGCCGCC

Variant summary

Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3

The NM_005249.5(FOXG1):​c.183_206dupCGCCCCGCAACCGCCGCCGCCGCC​(p.Pro69_Gln70insAlaProGlnProProProProPro) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000000949 in 1,053,830 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. P69P) has been classified as Likely benign.

• Frequency:
  • Genomes: not found (cov: 31)
  • Exomes 𝑓: 9.5e-7 (0 hom.)
• Consequence: FOXG1 NM_005249.5 disruptive_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.544
• Publications: 0 publications found

Genes affected

FOXG1 (HGNC:3811): (forkhead box G1) This locus encodes a member of the fork-head transcription factor family. The encoded protein, which functions as a transcriptional repressor, is highly expressed in neural tissues during brain development. Mutations at this locus have been associated with Rett syndrome and a diverse spectrum of neurodevelopmental disorders defined as part of the FOXG1 syndrome. This gene is disregulated in many types of cancer and is the target of multiple microRNAs that regulate the proliferation of tumor cells. [provided by RefSeq, Jul 2020]

LINC01551 (HGNC:19828): (long intergenic non-protein coding RNA 1551)

ACMG classification

Our verdict: Likely_benign. The variant received -1 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_005249.5

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_005249.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	FOXG1	NM_005249.5	MANE Select	c.183_206dupCGCCCCGCAACCGCCGCCGCCGCC	p.Pro69_Gln70insAlaProGlnProProProProPro	disruptive_inframe_insertion	Exon 1 of 1	NP_005240.3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	FOXG1	ENST00000313071.7	TSL:6 MANE Select	c.183_206dupCGCCCCGCAACCGCCGCCGCCGCC	p.Pro69_Gln70insAlaProGlnProProProProPro	disruptive_inframe_insertion	Exon 1 of 1	ENSP00000339004.3
	FOXG1	ENST00000706482.1		c.183_206dupCGCCCCGCAACCGCCGCCGCCGCC	p.Pro69_Gln70insAlaProGlnProProProProPro	disruptive_inframe_insertion	Exon 2 of 2	ENSP00000516406.1
	LINC01551	ENST00000675861.1		n.374+1449_374+1472dupCGCCCCGCAACCGCCGCCGCCGCC		intron	N/A

Frequencies

GnomAD3 genomes Cov.: 31

GnomAD4 exome AF: 9.49e-7 AC: 1 AN: 1053830 Hom.: 0 Cov.: 22 AF XY: 0.00 AC XY: 0 AN XY: 513910

African (AFR) AF: 0.00 AC: 0 AN: 21270

American (AMR) AF: 0.00 AC: 0 AN: 20324

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 15010

East Asian (EAS) AF: 0.00 AC: 0 AN: 17272

South Asian (SAS) AF: 0.00 AC: 0 AN: 44656

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 22902

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 2726

European-Non Finnish (NFE) AF: 0.00000115 AC: 1 AN: 871410

Other (OTH) AF: 0.00 AC: 0 AN: 38260

GnomAD4 genome Cov.: 31

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.54

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs587783632; hg19: chr14-29236656;