chr14-28767450-C-CCCGCCGCCGCCCGCCCCGCAACCG
Variant summary
Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3
The NM_005249.5(FOXG1):c.183_206dupCGCCCCGCAACCGCCGCCGCCGCC(p.Pro69_Gln70insAlaProGlnProProProProPro) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000000949 in 1,053,830 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. P69P) has been classified as Likely benign.
Frequency
Consequence
NM_005249.5 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -1 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_005249.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| FOXG1 | NM_005249.5 | MANE Select | c.183_206dupCGCCCCGCAACCGCCGCCGCCGCC | p.Pro69_Gln70insAlaProGlnProProProProPro | disruptive_inframe_insertion | Exon 1 of 1 | NP_005240.3 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| FOXG1 | ENST00000313071.7 | TSL:6 MANE Select | c.183_206dupCGCCCCGCAACCGCCGCCGCCGCC | p.Pro69_Gln70insAlaProGlnProProProProPro | disruptive_inframe_insertion | Exon 1 of 1 | ENSP00000339004.3 | P55316 | |
| FOXG1 | ENST00000706482.1 | c.183_206dupCGCCCCGCAACCGCCGCCGCCGCC | p.Pro69_Gln70insAlaProGlnProProProProPro | disruptive_inframe_insertion | Exon 2 of 2 | ENSP00000516406.1 | P55316 | ||
| LINC01551 | ENST00000675861.1 | n.374+1449_374+1472dupCGCCCCGCAACCGCCGCCGCCGCC | intron | N/A |
Frequencies
GnomAD3 genomes Cov.: 31
GnomAD4 exome AF: 9.49e-7 AC: 1AN: 1053830Hom.: 0 Cov.: 22 AF XY: 0.00 AC XY: 0AN XY: 513910 show subpopulations
Age Distribution
GnomAD4 genome Cov.: 31
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at