14-28767473-CGCCGCCGCCGCCGCAGCAGCAGCA-C

Variant names:

• chr14-28767473-CGCCGCCGCCGCCGCAGCAGCAGCA-C
• rs794726920
• NM_005249.5:c.209_232delAGCAGCAGCAGCCGCCGCCGCCGC

Variant summary

Our verdict is Benign. The variant received -17 ACMG points: 0P and 17B. BP5_Strong BS2 BA1 BP3

This summary comes from the ClinGen Evidence Repository: The allele frequency of the p.Q70_P77del variant in FOXG1 is 0.03% in gnomAD, which is high enough to be classified as benign based on thresholds defined by the ClinGen Rett/Angelman-like Expert Panel for Rett/AS-like conditions (BA1). The p.Q70_P77del variant is observed in at least 2 unaffected individuals (internal database) (BS2). The p.Q70_P77del variant is an in-frame deletion present in a repetitive region of FOXG1 (BP3). The p.Q70_P77del variant is found in at least 3 patients with an alternate molecular basis of disease (internal database) (BP5_strong). In summary, the p.Q70_P77del variant in FOXG1 is classified as benign based on the ACMG/AMP criteria (BA1, BS2, BP3, BP5_strong). LINK:https://erepo.genome.network/evrepo/ui/classification/CA238814/MONDO:0100040/016

• Frequency:
  • Genomes: 𝑓 0.00019 (0 hom., cov: 31)
  • Exomes 𝑓: 0.00014 (0 hom.)
• Consequence: FOXG1 NM_005249.5 disruptive_inframe_deletion
• Clinical Significance: Benign reviewed by expert panel B:6
• Conservation: PhyloP100: 2.38
• Publications: 1 publications found

Genes affected

FOXG1 (HGNC:3811): (forkhead box G1) This locus encodes a member of the fork-head transcription factor family. The encoded protein, which functions as a transcriptional repressor, is highly expressed in neural tissues during brain development. Mutations at this locus have been associated with Rett syndrome and a diverse spectrum of neurodevelopmental disorders defined as part of the FOXG1 syndrome. This gene is disregulated in many types of cancer and is the target of multiple microRNAs that regulate the proliferation of tumor cells. [provided by RefSeq, Jul 2020]

LINC01551 (HGNC:19828): (long intergenic non-protein coding RNA 1551)

ACMG classification

Specifications for FOXG1 are available in the ClinGen Criteria Specification Registry and recommended for reference when assigning criteria.

Our verdict: Benign. The variant received -17 ACMG points.

• BP3: For more information check the summary or visit ClinGen Evidence Repository.
• BP5: For more information check the summary or visit ClinGen Evidence Repository.
• BS2: For more information check the summary or visit ClinGen Evidence Repository.
• BA1: For more information check the summary or visit ClinGen Evidence Repository.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_005249.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	FOXG1	NM_005249.5	MANE Select	c.209_232delAGCAGCAGCAGCCGCCGCCGCCGC	p.Gln70_Pro77del	disruptive_inframe_deletion	Exon 1 of 1	NP_005240.3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	FOXG1	ENST00000313071.7	TSL:6 MANE Select	c.209_232delAGCAGCAGCAGCCGCCGCCGCCGC	p.Gln70_Pro77del	disruptive_inframe_deletion	Exon 1 of 1	ENSP00000339004.3	P55316
	FOXG1	ENST00000706482.1		c.209_232delAGCAGCAGCAGCCGCCGCCGCCGC	p.Gln70_Pro77del	disruptive_inframe_deletion	Exon 2 of 2	ENSP00000516406.1	P55316
	LINC01551	ENST00000675861.1		n.374+1475_374+1498delAGCAGCAGCAGCCGCCGCCGCCGC		intron	N/A

Frequencies

GnomAD3 genomes AF: 0.000186 AC: 27 AN: 145534 Hom.: 0 Cov.: 31

Gnomad AFR AF: 0.0000494

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000682

Gnomad ASJ AF: 0.00533

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.000212

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000610

Gnomad OTH AF: 0.000499

GnomAD2 exomes AF: 0.000412 AC: 30 AN: 72812 AF XY: 0.000381

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00381

Gnomad EAS exome AF: 0.000413

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.000111

Gnomad OTH exome AF: 0.000488

GnomAD4 exome AF: 0.000136 AC: 130 AN: 957120 Hom.: 0 AF XY: 0.000134 AC XY: 62 AN XY: 463428

African (AFR) AF: 0.0000519 AC: 1 AN: 19284

American (AMR) AF: 0.00 AC: 0 AN: 18346

Ashkenazi Jewish (ASJ) AF: 0.00610 AC: 80 AN: 13114

East Asian (EAS) AF: 0.0000773 AC: 1 AN: 12942

South Asian (SAS) AF: 0.0000536 AC: 2 AN: 37290

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 15564

Middle Eastern (MID) AF: 0.000429 AC: 1 AN: 2330

European-Non Finnish (NFE) AF: 0.0000398 AC: 32 AN: 804204

Other (OTH) AF: 0.000382 AC: 13 AN: 34046

GnomAD4 genome AF: 0.000186 AC: 27 AN: 145534 Hom.: 0 Cov.: 31 AF XY: 0.0000707 AC XY: 5 AN XY: 70698

African (AFR) AF: 0.0000494 AC: 2 AN: 40502

American (AMR) AF: 0.0000682 AC: 1 AN: 14666

Ashkenazi Jewish (ASJ) AF: 0.00533 AC: 18 AN: 3374

East Asian (EAS) AF: 0.00 AC: 0 AN: 5052

South Asian (SAS) AF: 0.000212 AC: 1 AN: 4722

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 8432

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 302

European-Non Finnish (NFE) AF: 0.0000610 AC: 4 AN: 65576

Other (OTH) AF: 0.000499 AC: 1 AN: 2004

Alfa AF: 0.000169 Hom.: 0

ClinVar

ClinVar submissions

Significance: Benign

Revision: reviewed by expert panel

Pathogenic	VUS	Benign	Condition
-	-	2	FOXG1 disorder (2)
-	-	1	FOXG1-related disorder (1)
-	-	1	Inborn genetic diseases (1)
-	-	1	not provided (1)
-	-	1	not specified (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.4
Mutation Taster		=158/42	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs794726920; hg19: chr14-29236679;