rs794726920

Positions:

• chr14-28767473-CGCCGCCGCCGCCGCAGCAGCAGCA-C
• chr14-28767473-CGCCGCCGCCGCCGCAGCAGCAGCA-CGCCGCCGCCGCCGCAGCAGCAGCAGCCGCCGCCGCCGCAGCAGCAGCA

Variant summary

Our verdict is Benign. Variant got -17 ACMG points: 0P and 17B. BA1 BP3 BP5_Strong BS2

This summary comes from the ClinGen Evidence Repository: The allele frequency of the p.Q70_P77del variant in FOXG1 is 0.03% in gnomAD, which is high enough to be classified as benign based on thresholds defined by the ClinGen Rett/Angelman-like Expert Panel for Rett/AS-like conditions (BA1). The p.Q70_P77del variant is observed in at least 2 unaffected individuals (internal database) (BS2). The p.Q70_P77del variant is an in-frame deletion present in a repetitive region of FOXG1 (BP3). The p.Q70_P77del variant is found in at least 3 patients with an alternate molecular basis of disease (internal database) (BP5_strong). In summary, the p.Q70_P77del variant in FOXG1 is classified as benign based on the ACMG/AMP criteria (BA1, BS2, BP3, BP5_strong). LINK:https://erepo.genome.network/evrepo/ui/classification/CA238814/MONDO:0100040/016

• Frequency:
  • Genomes: 𝑓 0.00019 (0 hom., cov: 31)
  • Exomes 𝑓: 0.00014 (0 hom.)
• Consequence: FOXG1 NM_005249.5 disruptive_inframe_deletion
• Clinical Significance: Benign reviewed by expert panel B:6
• Conservation: PhyloP100: 2.38

Genes affected

FOXG1 (HGNC:3811): (forkhead box G1) This locus encodes a member of the fork-head transcription factor family. The encoded protein, which functions as a transcriptional repressor, is highly expressed in neural tissues during brain development. Mutations at this locus have been associated with Rett syndrome and a diverse spectrum of neurodevelopmental disorders defined as part of the FOXG1 syndrome. This gene is disregulated in many types of cancer and is the target of multiple microRNAs that regulate the proliferation of tumor cells. [provided by RefSeq, Jul 2020]

LINC01551 (HGNC:):

ACMG classification

Verdict is Benign. Variant got -17 ACMG points.

• BP3: For more information check the summary or visit ClinGen Evidence Repository.
• BP5: For more information check the summary or visit ClinGen Evidence Repository.
• BS2: For more information check the summary or visit ClinGen Evidence Repository.
• BA1: For more information check the summary or visit ClinGen Evidence Repository.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
FOXG1	NM_005249.5	c.209_232delAGCAGCAGCAGCCGCCGCCGCCGC	p.Gln70_Pro77del	disruptive_inframe_deletion	1/1	ENST00000313071.7	NP_005240.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
FOXG1	ENST00000313071.7	c.209_232delAGCAGCAGCAGCCGCCGCCGCCGC	p.Gln70_Pro77del	disruptive_inframe_deletion	1/1	6	NM_005249.5	ENSP00000339004.3
FOXG1	ENST00000706482.1	c.209_232delAGCAGCAGCAGCCGCCGCCGCCGC	p.Gln70_Pro77del	disruptive_inframe_deletion	2/2			ENSP00000516406.1
LINC01551	ENST00000675861.1	n.374+1475_374+1498delAGCAGCAGCAGCCGCCGCCGCCGC		intron_variant

Frequencies

GnomAD3 genomes AF: 0.000186 AC: 27 AN: 145534 Hom.: 0 Cov.: 31

Gnomad AFR AF: 0.0000494

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000682

Gnomad ASJ AF: 0.00533

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.000212

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000610

Gnomad OTH AF: 0.000499

GnomAD3 exomes AF: 0.000412 AC: 30 AN: 72812 Hom.: 0 AF XY: 0.000381 AC XY: 16 AN XY: 42020

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00381

Gnomad EAS exome AF: 0.000413

Gnomad SAS exome AF: 0.0000635

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.000111

Gnomad OTH exome AF: 0.000488

GnomAD4 exome AF: 0.000136 AC: 130 AN: 957120 Hom.: 0 AF XY: 0.000134 AC XY: 62 AN XY: 463428

Gnomad4 AFR exome AF: 0.0000519

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00610

Gnomad4 EAS exome AF: 0.0000773

Gnomad4 SAS exome AF: 0.0000536

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.0000398

Gnomad4 OTH exome AF: 0.000382

GnomAD4 genome AF: 0.000186 AC: 27 AN: 145534 Hom.: 0 Cov.: 31 AF XY: 0.0000707 AC XY: 5 AN XY: 70698

Gnomad4 AFR AF: 0.0000494

Gnomad4 AMR AF: 0.0000682

Gnomad4 ASJ AF: 0.00533

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.000212

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000610

Gnomad4 OTH AF: 0.000499

Alfa AF: 0.000169 Hom.: 0

ClinVar

Significance: Benign

Submissions summary: Benign:6

Revision: reviewed by expert panel

Submissions by phenotype

not specified Benign:1

Likely benign, criteria provided, single submitter

clinical testing

Eurofins Ntd Llc (ga)

May 27, 2015

- -

Inborn genetic diseases Benign:1

Likely benign, criteria provided, single submitter

clinical testing

Ambry Genetics

Aug 28, 2018

This alteration is classified as likely benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity. -

not provided Benign:1

Benign, criteria provided, single submitter

clinical testing

GeneDx

Dec 16, 2019

- -

FOXG1 disorder Benign:1

Benign, reviewed by expert panel

curation

ClinGen Rett and Angelman-like Disorders Variant Curation Expert Panel

Mar 26, 2021

The allele frequency of the p.Q70_P77del variant in FOXG1 is 0.03% in gnomAD, which is high enough to be classified as benign based on thresholds defined by the ClinGen Rett/Angelman-like Expert Panel for Rett/AS-like conditions (BA1). The p.Q70_P77del variant is observed in at least 2 unaffected individuals (internal database) (BS2). The p.Q70_P77del variant is an in-frame deletion present in a repetitive region of FOXG1 (BP3). The p.Q70_P77del variant is found in at least 3 patients with an alternate molecular basis of disease (internal database) (BP5_strong). In summary, the p.Q70_P77del variant in FOXG1 is classified as benign based on the ACMG/AMP criteria (BA1, BS2, BP3, BP5_strong). -

FOXG1-related disorder Benign:1

Likely benign, no assertion criteria provided

clinical testing

PreventionGenetics, part of Exact Sciences

Sep 27, 2021

This variant is classified as likely benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications). -

Rett syndrome, congenital variant Benign:1

Likely benign, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Dec 13, 2023

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs794726920; hg19: chr14-29236679;