14-36520065-G-GGGCTGCTCCTCCCTCCCGCCGC

Variant summary

Our verdict is Likely pathogenic. Variant got 8 ACMG points: 8P and 0B. PVS1_StrongPM2PP5_Moderate

The NM_001079668.3(NKX2-1):​c.43_64dupGCGGCGGGAGGGAGGAGCAGCC​(p.Pro22ArgfsTer31) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).

Frequency

Genomes: not found (cov: 33)

Consequence

NKX2-1
NM_001079668.3 frameshift

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 1.18
Variant links:
Genes affected
NKX2-1 (HGNC:11825): (NK2 homeobox 1) This gene encodes a protein initially identified as a thyroid-specific transcription factor. The encoded protein binds to the thyroglobulin promoter and regulates the expression of thyroid-specific genes but has also been shown to regulate the expression of genes involved in morphogenesis. Mutations and deletions in this gene are associated with benign hereditary chorea, choreoathetosis, congenital hypothyroidism, and neonatal respiratory distress, and may be associated with thyroid cancer. Multiple transcript variants encoding different isoforms have been found for this gene. This gene shares the symbol/alias 'TTF1' with another gene, transcription termination factor 1, which plays a role in ribosomal gene transcription. [provided by RefSeq, Feb 2014]
NKX2-1-AS1 (HGNC:40585): (NKX2-1 antisense RNA 1)

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Likely_pathogenic. Variant got 8 ACMG points.

PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 10 pathogenic variants in the truncated region.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 14-36520065-G-GGGCTGCTCCTCCCTCCCGCCGC is Pathogenic according to our data. Variant chr14-36520065-G-GGGCTGCTCCTCCCTCCCGCCGC is described in ClinVar as [Pathogenic]. Clinvar id is 3339885.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
NKX2-1NM_001079668.3 linkc.43_64dupGCGGCGGGAGGGAGGAGCAGCC p.Pro22ArgfsTer31 frameshift_variant Exon 1 of 3 ENST00000354822.7 NP_001073136.1 P43699-3
NKX2-1-AS1NR_103710.1 linkn.402+390_402+411dupTGCTCCTCCCTCCCGCCGCGGC intron_variant Intron 1 of 1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
NKX2-1ENST00000354822.7 linkc.43_64dupGCGGCGGGAGGGAGGAGCAGCC p.Pro22ArgfsTer31 frameshift_variant Exon 1 of 3 1 NM_001079668.3 ENSP00000346879.6 P43699-3
SFTA3ENST00000546983.2 linkn.-14+470_-14+491dupGCGGCGGGAGGGAGGAGCAGCC intron_variant Intron 1 of 3 4 ENSP00000449302.2 F8VVG2

Frequencies

GnomAD3 genomes
Cov.:
33
GnomAD4 exome
Cov.:
31
GnomAD4 genome
Cov.:
33

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Benign hereditary chorea Pathogenic:1
Jun 21, 2024
Women's Health and Genetics/Laboratory Corporation of America, LabCorp
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

Variant summary: NKX2-1 c.43_64dup22 (p.Pro22ArgfsX31) results in a premature termination codon, predicted to cause a truncation of the encoded protein or absence of the protein due to nonsense mediated decay, which are commonly known mechanisms for disease. The variant was absent in 239050 control chromosomes. To our knowledge, no occurrence of c.43_64dup22 in individuals affected with &phenotype& and no experimental evidence demonstrating its impact on protein function have been reported. No submitters have cited clinical-significance assessments for this variant to ClinVar. Based on the evidence outlined above, the variant was classified as pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr14-36989270; API