14-92071010-CCTGCTGCTGCTG-CCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG

Variant names:

• chr14-92071010-C-CCTGCTGCTGCTGCTGCTGCTGCTG
• rs193922928
• NM_004993.6:c.892_915dupCAGCAGCAGCAGCAGCAGCAGCAG

Variant summary

Our verdict is Benign. The variant received -11 ACMG points: 0P and 11B. BP3 BP6_Moderate BA1

The NM_004993.6(ATXN3):​c.892_915dupCAGCAGCAGCAGCAGCAGCAGCAG​(p.Gln298_Gln305dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★).

• Frequency:
  • Genomes: 𝑓 0.042 (563 hom., cov: 20)
  • Exomes 𝑓: 0.043 (2021 hom.)
  • Failed GnomAD Quality Control
• Consequence: ATXN3 NM_004993.6 conservative_inframe_insertion
• Clinical Significance: Likely benign criteria provided, single submitter B:2
• Conservation: PhyloP100: -0.168
• Publications: 1 publications found

Genes affected

ATXN3 (HGNC:7106): (ataxin 3) Machado-Joseph disease, also known as spinocerebellar ataxia-3, is an autosomal dominant neurologic disorder. The protein encoded by this gene contains (CAG)n repeats in the coding region, and the expansion of these repeats from the normal 12-44 to 52-86 is one cause of Machado-Joseph disease. There is a negative correlation between the age of onset and CAG repeat numbers. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2016]

ATXN3 Gene-Disease associations (from GenCC):

• Machado-Joseph disease

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine
• Machado-Joseph disease type 1

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Machado-Joseph disease type 2

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Machado-Joseph disease type 3

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ENSG00000303901 (HGNC:):

ACMG classification

Our verdict: Benign. The variant received -11 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_004993.6
• BP6: Variant 14-92071010-C-CCTGCTGCTGCTGCTGCTGCTGCTG is Benign according to our data. Variant chr14-92071010-C-CCTGCTGCTGCTGCTGCTGCTGCTG is described in ClinVar as Likely_benign. ClinVar VariationId is 3055415.Status of the report is criteria_provided_single_submitter, 1 stars.
• BA1: GnomAd4 highest subpopulation (AFR) allele frequency at 95% confidence interval = 0.148 is higher than 0.05.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_004993.6. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ATXN3	NM_004993.6	MANE Select	c.892_915dupCAGCAGCAGCAGCAGCAGCAGCAG	p.Gln298_Gln305dup	conservative_inframe_insertion	Exon 10 of 11	NP_004984.2
	ATXN3	NM_001127696.2		c.847_870dupCAGCAGCAGCAGCAGCAGCAGCAG	p.Gln283_Gln290dup	conservative_inframe_insertion	Exon 9 of 10	NP_001121168.1	P54252-4
	ATXN3	NM_001127697.3		c.739_762dupCAGCAGCAGCAGCAGCAGCAGCAG	p.Gln247_Gln254dup	conservative_inframe_insertion	Exon 8 of 9	NP_001121169.2	A0A0A0MS38

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ATXN3	ENST00000644486.2	MANE Select	c.892_915dupCAGCAGCAGCAGCAGCAGCAGCAG	p.Gln298_Gln305dup	conservative_inframe_insertion	Exon 10 of 11	ENSP00000496695.1	P54252-2
	ATXN3	ENST00000532032.5	TSL:1	c.892_915dupCAGCAGCAGCAGCAGCAGCAGCAG	p.Gln298_Gln305dup	conservative_inframe_insertion	Exon 10 of 10	ENSP00000437157.1	P54252-1
	ATXN3	ENST00000503767.5	TSL:1	c.847_870dupCAGCAGCAGCAGCAGCAGCAGCAG	p.Gln283_Gln290dup	conservative_inframe_insertion	Exon 9 of 10	ENSP00000426697.1	P54252-4

Frequencies

GnomAD3 genomes AF: 0.0419 AC: 5960 AN: 142264 Hom.: 558 Cov.: 20

Gnomad AFR AF: 0.151

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0151

Gnomad ASJ AF: 0.00117

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00278

Gnomad FIN AF: 0.00132

Gnomad MID AF: 0.0230

Gnomad NFE AF: 0.00307

Gnomad OTH AF: 0.0237

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0427 AC: 53693 AN: 1256914 Hom.: 2021 Cov.: 92 AF XY: 0.0411 AC XY: 25806 AN XY: 627840

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.181 AC: 4930 AN: 27232

American (AMR) AF: 0.0639 AC: 2381 AN: 37264

Ashkenazi Jewish (ASJ) AF: 0.0345 AC: 797 AN: 23116

East Asian (EAS) AF: 0.000721 AC: 27 AN: 37440

South Asian (SAS) AF: 0.0302 AC: 2281 AN: 75472

European-Finnish (FIN) AF: 0.0111 AC: 521 AN: 46978

Middle Eastern (MID) AF: 0.0428 AC: 209 AN: 4888

European-Non Finnish (NFE) AF: 0.0424 AC: 40351 AN: 951922

Other (OTH) AF: 0.0417 AC: 2196 AN: 52602

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.0420 AC: 5976 AN: 142374 Hom.: 563 Cov.: 20 AF XY: 0.0408 AC XY: 2824 AN XY: 69154

African (AFR) AF: 0.151 AC: 5473 AN: 36278

American (AMR) AF: 0.0150 AC: 216 AN: 14382

Ashkenazi Jewish (ASJ) AF: 0.00117 AC: 4 AN: 3412

East Asian (EAS) AF: 0.00 AC: 0 AN: 4634

South Asian (SAS) AF: 0.00302 AC: 13 AN: 4310

European-Finnish (FIN) AF: 0.00132 AC: 13 AN: 9850

Middle Eastern (MID) AF: 0.0248 AC: 7 AN: 282

European-Non Finnish (NFE) AF: 0.00307 AC: 204 AN: 66386

Other (OTH) AF: 0.0235 AC: 46 AN: 1960

Alfa AF: 0.00 Hom.: 345

ClinVar

ClinVar submissions

Significance: Likely benign

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	-	1	ATXN3-related disorder (1)
-	-	1	not specified (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		-0.17
Mutation Taster		=80/20	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs193922928; hg19: chr14-92537354; COSMIC: COSV61493808; COSMIC: COSV61493808;