chr14-92071010-C-CCTGCTGCTGCTGCTGCTGCTGCTG
Variant summary
Our verdict is Benign. The variant received -11 ACMG points: 0P and 11B. BP3BP6_ModerateBA1
The NM_004993.6(ATXN3):c.892_915dupCAGCAGCAGCAGCAGCAGCAGCAG(p.Gln298_Gln305dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★).
Frequency
Consequence
NM_004993.6 conservative_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- Machado-Joseph diseaseInheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Laboratory for Molecular Medicine, Labcorp Genetics (formerly Invitae)
- Machado-Joseph disease type 1Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Machado-Joseph disease type 2Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Machado-Joseph disease type 3Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Benign. The variant received -11 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| ATXN3 | NM_004993.6 | c.892_915dupCAGCAGCAGCAGCAGCAGCAGCAG | p.Gln298_Gln305dup | conservative_inframe_insertion | Exon 10 of 11 | ENST00000644486.2 | NP_004984.2 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| ATXN3 | ENST00000644486.2 | c.892_915dupCAGCAGCAGCAGCAGCAGCAGCAG | p.Gln298_Gln305dup | conservative_inframe_insertion | Exon 10 of 11 | NM_004993.6 | ENSP00000496695.1 |
Frequencies
GnomAD3 genomes AF: 0.0419 AC: 5960AN: 142264Hom.: 558 Cov.: 20 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0427 AC: 53693AN: 1256914Hom.: 2021 Cov.: 92 AF XY: 0.0411 AC XY: 25806AN XY: 627840 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome AF: 0.0420 AC: 5976AN: 142374Hom.: 563 Cov.: 20 AF XY: 0.0408 AC XY: 2824AN XY: 69154 show subpopulations
Age Distribution
ClinVar
Submissions by phenotype
not specified Benign:1
ATXN3-related disorder Benign:1
This variant is classified as benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications).
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at