15-60500962-CTGACATCAGTACAAATGCAGAAA-AT
Variant summary
Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate
The NM_134261.3(RORA):c.1268_1291delTTTCTGCATTTGTACTGATGTCAGinsAT(p.Phe423fs) variant causes a frameshift, missense change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.
Frequency
Genomes: not found (cov: 32)
Consequence
RORA
NM_134261.3 frameshift, missense
NM_134261.3 frameshift, missense
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 9.41
Genes affected
RORA (HGNC:10258): (RAR related orphan receptor A) The protein encoded by this gene is a member of the NR1 subfamily of nuclear hormone receptors. It can bind as a monomer or as a homodimer to hormone response elements upstream of several genes to enhance the expression of those genes. The encoded protein has been shown to interact with NM23-2, a nucleoside diphosphate kinase involved in organogenesis and differentiation, as well as with NM23-1, the product of a tumor metastasis suppressor candidate gene. Also, it has been shown to aid in the transcriptional regulation of some genes involved in circadian rhythm. Four transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Feb 2014]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Pathogenic. Variant got 12 ACMG points.
PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 15-60500962-CTGACATCAGTACAAATGCAGAAA-AT is Pathogenic according to our data. Variant chr15-60500962-CTGACATCAGTACAAATGCAGAAA-AT is described in ClinVar as [Pathogenic]. Clinvar id is 2304091.Status of the report is criteria_provided_single_submitter, 1 stars.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
RORA | NM_134261.3 | c.1268_1291delTTTCTGCATTTGTACTGATGTCAGinsAT | p.Phe423fs | frameshift_variant, missense_variant | 9/11 | ENST00000335670.11 | NP_599023.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
RORA | ENST00000335670.11 | c.1268_1291delTTTCTGCATTTGTACTGATGTCAGinsAT | p.Phe423fs | frameshift_variant, missense_variant | 9/11 | 1 | NM_134261.3 | ENSP00000335087.6 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 32
GnomAD4 genome
Cov.:
32
ClinVar
Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link
Submissions by phenotype
Inborn genetic diseases Pathogenic:1
Pathogenic, criteria provided, single submitter | clinical testing | Ambry Genetics | Aug 12, 2022 | The c.1268_1291del24insAT (p.F423Yfs*11) alteration, located in exon 9 (coding exon 9) of the RORA gene, consists of a deletion of 24 and insertion of 2 nucleotides causing a translational frameshift at position 1268 with a predicted alternate stop codon after 11 amino acids. This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. This variant was not reported in population-based cohorts in the Genome Aggregation Database (gnomAD). Based on the available evidence, this alteration is classified as pathogenic. - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
Publications
No publications associated with this variant yet.