15-60500962-CTGACATCAGTACAAATGCAGAAA-AT

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate

The NM_134261.3(RORA):​c.1268_1291delTTTCTGCATTTGTACTGATGTCAGinsAT​(p.Phe423TyrfsTer11) variant causes a frameshift, missense change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 32)

Consequence

RORA
NM_134261.3 frameshift, missense

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 9.41
Variant links:
Genes affected
RORA (HGNC:10258): (RAR related orphan receptor A) The protein encoded by this gene is a member of the NR1 subfamily of nuclear hormone receptors. It can bind as a monomer or as a homodimer to hormone response elements upstream of several genes to enhance the expression of those genes. The encoded protein has been shown to interact with NM23-2, a nucleoside diphosphate kinase involved in organogenesis and differentiation, as well as with NM23-1, the product of a tumor metastasis suppressor candidate gene. Also, it has been shown to aid in the transcriptional regulation of some genes involved in circadian rhythm. Four transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Feb 2014]
RORA-AS1 (HGNC:51410): (RORA antisense RNA 1)

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 12 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 15-60500962-CTGACATCAGTACAAATGCAGAAA-AT is Pathogenic according to our data. Variant chr15-60500962-CTGACATCAGTACAAATGCAGAAA-AT is described in ClinVar as [Pathogenic]. Clinvar id is 2304091.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
RORANM_134261.3 linkc.1268_1291delTTTCTGCATTTGTACTGATGTCAGinsAT p.Phe423TyrfsTer11 frameshift_variant, missense_variant Exon 9 of 11 ENST00000335670.11 NP_599023.1 P35398-2

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
RORAENST00000335670.11 linkc.1268_1291delTTTCTGCATTTGTACTGATGTCAGinsAT p.Phe423TyrfsTer11 frameshift_variant, missense_variant Exon 9 of 11 1 NM_134261.3 ENSP00000335087.6 P35398-2

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Inborn genetic diseases Pathogenic:1
Aug 12, 2022
Ambry Genetics
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

The c.1268_1291del24insAT (p.F423Yfs*11) alteration, located in exon 9 (coding exon 9) of the RORA gene, consists of a deletion of 24 and insertion of 2 nucleotides causing a translational frameshift at position 1268 with a predicted alternate stop codon after 11 amino acids. This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. This variant was not reported in population-based cohorts in the Genome Aggregation Database (gnomAD). Based on the available evidence, this alteration is classified as pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr15-60793161; API