chr15-60500962-CTGACATCAGTACAAATGCAGAAA-AT

Variant names:

• chr15-60500962-CTGACATCAGTACAAATGCAGAAA-AT
• NM_134261.3:c.1268_1291delTTTCTGCATTTGTACTGATGTCAGinsAT

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_134261.3(RORA):​c.1268_1291delTTTCTGCATTTGTACTGATGTCAGinsAT​(p.Phe423TyrfsTer11) variant causes a frameshift, missense change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: RORA NM_134261.3 frameshift, missense
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 9.41
• Publications: 0 publications found

Genes affected

RORA (HGNC:10258): (RAR related orphan receptor A) The protein encoded by this gene is a member of the NR1 subfamily of nuclear hormone receptors. It can bind as a monomer or as a homodimer to hormone response elements upstream of several genes to enhance the expression of those genes. The encoded protein has been shown to interact with NM23-2, a nucleoside diphosphate kinase involved in organogenesis and differentiation, as well as with NM23-1, the product of a tumor metastasis suppressor candidate gene. Also, it has been shown to aid in the transcriptional regulation of some genes involved in circadian rhythm. Four transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Feb 2014]

RORA-AS1 (HGNC:51410): (RORA antisense RNA 1)

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 15-60500962-CTGACATCAGTACAAATGCAGAAA-AT is Pathogenic according to our data. Variant chr15-60500962-CTGACATCAGTACAAATGCAGAAA-AT is described in ClinVar as Pathogenic. ClinVar VariationId is 2304091.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_134261.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RORA	NM_134261.3	MANE Select	c.1268_1291delTTTCTGCATTTGTACTGATGTCAGinsAT	p.Phe423TyrfsTer11	frameshift missense	Exon 9 of 11	NP_599023.1	P35398-2
	RORA	NM_134260.3		c.1367_1390delTTTCTGCATTTGTACTGATGTCAGinsAT	p.Phe456TyrfsTer11	frameshift missense	Exon 10 of 12	NP_599022.1	P35398-1
	RORA	NM_002943.4		c.1343_1366delTTTCTGCATTTGTACTGATGTCAGinsAT	p.Phe448TyrfsTer11	frameshift missense	Exon 9 of 11	NP_002934.1	A0A0C4DFP5

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RORA	ENST00000335670.11	TSL:1 MANE Select	c.1268_1291delTTTCTGCATTTGTACTGATGTCAGinsAT	p.Phe423TyrfsTer11	frameshift missense	Exon 9 of 11	ENSP00000335087.6	P35398-2
	RORA	ENST00000261523.9	TSL:1	c.1367_1390delTTTCTGCATTTGTACTGATGTCAGinsAT	p.Phe456TyrfsTer11	frameshift missense	Exon 10 of 12	ENSP00000261523.5	P35398-1
	RORA	ENST00000309157.8	TSL:1	c.1343_1366delTTTCTGCATTTGTACTGATGTCAGinsAT	p.Phe448TyrfsTer11	frameshift missense	Exon 9 of 11	ENSP00000309753.3	A0A0C4DFP5

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	Inborn genetic diseases (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.4

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

hg19: chr15-60793161;