15-89333596-TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC-TTGC

Variant names:

• chr15-89333596-TTGCTGCTGCTGCTGCTGCTGCTGCTGC-T
• rs41550117
• NM_001430120.1:c.187_213delGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Uncertain significance. The variant received 1 ACMG points: 2P and 1B. PM1 BP3

The NM_001430120.1(POLGARF):​c.187_213delGCAGCAGCAGCAGCAGCAGCAGCAGCA​(p.Ala63_Ala71del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. A63A) has been classified as Likely benign.

• Frequency:
  • Genomes: not found (cov: 30)
  • Exomes 𝑓: 0.0000048 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: POLGARF NM_001430120.1 conservative_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 0.0750
• Publications: 0 publications found

Genes affected

POLGARF (HGNC:56246): (POLG alternative reading frame) This gene uses the same transcript as the POLG gene but has a CUG start codon and an alternate reading frame that makes a 260 aa protein. This protein is distinct from POLG isoforms and may interact with P32 (also known as C1QBP), a mitochondrial matrix protein thought to be involved in the expression of mitochondrial genome-encoded proteins. POLGARF protein may bind P32 and sequester it in the nucleolus. Interestingly, some disease-causing mutations thought to be in POLG may instead be associated with POLGARF. [provided by RefSeq, May 2022]

POLG (HGNC:9179): (DNA polymerase gamma, catalytic subunit) Mitochondrial DNA polymerase is heterotrimeric, consisting of a homodimer of accessory subunits plus a catalytic subunit. The protein encoded by this gene is the catalytic subunit of mitochondrial DNA polymerase. The encoded protein contains a polyglutamine tract near its N-terminus that may be polymorphic. Defects in this gene are a cause of progressive external ophthalmoplegia with mitochondrial DNA deletions 1 (PEOA1), sensory ataxic neuropathy dysarthria and ophthalmoparesis (SANDO), Alpers-Huttenlocher syndrome (AHS), and mitochondrial neurogastrointestinal encephalopathy syndrome (MNGIE). Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]

POLG Gene-Disease associations (from GenCC):

• progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 1

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P
• mitochondrial DNA depletion syndrome 4a

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, Orphanet, Laboratory for Molecular Medicine, Labcorp Genetics (formerly Invitae), Ambry Genetics
• sensory ataxic neuropathy, dysarthria, and ophthalmoparesis

  Inheritance: AR Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics, G2P
• autosomal dominant progressive external ophthalmoplegia

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• autosomal recessive progressive external ophthalmoplegia

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• mitochondrial neurogastrointestinal encephalomyopathy

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• recessive mitochondrial ataxia syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• spinocerebellar ataxia with epilepsy

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• Leigh syndrome

  Inheritance: AR Classification: LIMITED Submitted by: ClinGen

ACMG classification

Our verdict: Uncertain_significance. The variant received 1 ACMG points.

• PM1: In a hotspot region, there are 4 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 11 benign, 14 uncertain in NM_001430120.1
• BP3: Nonframeshift variant in repetitive region in NM_001430120.1

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001430120.1. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	POLGARF	NM_001430120.1	MANE Select	c.187_213delGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Ala63_Ala71del	conservative_inframe_deletion	Exon 1 of 2	NP_001417049.1	A0A3B3IS91
	POLG	NM_002693.3	MANE Select	c.132_158delGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln45_Gln53del	disruptive_inframe_deletion	Exon 2 of 23	NP_002684.1	P54098
	POLG	NM_001126131.2		c.132_158delGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln45_Gln53del	disruptive_inframe_deletion	Exon 2 of 23	NP_001119603.1	P54098

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	POLGARF	ENST00000706918.1	MANE Select	c.187_213delGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Ala63_Ala71del	conservative_inframe_deletion	Exon 1 of 2	ENSP00000516626.1	A0A3B3IS91
	POLG	ENST00000268124.11	TSL:1 MANE Select	c.132_158delGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln45_Gln53del	disruptive_inframe_deletion	Exon 2 of 23	ENSP00000268124.5	P54098
	POLG	ENST00000442287.6	TSL:1	c.132_158delGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln45_Gln53del	disruptive_inframe_deletion	Exon 2 of 23	ENSP00000399851.2	P54098

Frequencies

GnomAD3 genomes Cov.: 30

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000484 AC: 7 AN: 1446396 Hom.: 0 AF XY: 0.00000695 AC XY: 5 AN XY: 719198

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 32852

American (AMR) AF: 0.00 AC: 0 AN: 43886

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 25858

East Asian (EAS) AF: 0.00 AC: 0 AN: 39412

South Asian (SAS) AF: 0.00 AC: 0 AN: 85292

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 48040

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5694

European-Non Finnish (NFE) AF: 0.00000633 AC: 7 AN: 1105660

Other (OTH) AF: 0.00 AC: 0 AN: 59702

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.0000397161), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Cov.: 30

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.075

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs41550117; hg19: chr15-89876827;