16-13947966-T-TCTTACACTTCACTTCCCCAGACTACGGA
Variant summary
Our verdict is Likely pathogenic. The variant received 6 ACMG points: 6P and 0B. PVS1_StrongPP5_Moderate
The NM_005236.3(ERCC4):c.2371_2398dupCTTACACTTCACTTCCCCAGACTACGGA(p.Ile800ThrfsTer24) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★).
Frequency
Consequence
NM_005236.3 frameshift
Scores
Clinical Significance
Conservation
Publications
- xeroderma pigmentosum group FInheritance: AR Classification: DEFINITIVE, STRONG Submitted by: ClinGen, G2P, Genomics England PanelApp
- Fanconi anemia complementation group QInheritance: AR Classification: STRONG, MODERATE Submitted by: Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae)
- XFE progeroid syndromeInheritance: AR Classification: STRONG Submitted by: Ambry Genetics
- Fanconi anemiaInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- xeroderma pigmentosumInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- xeroderma pigmentosum-Cockayne syndrome complexInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 6 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_005236.3. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ERCC4 | TSL:1 MANE Select | c.2371_2398dupCTTACACTTCACTTCCCCAGACTACGGA | p.Ile800ThrfsTer24 | frameshift | Exon 11 of 11 | ENSP00000310520.7 | Q92889-1 | ||
| ERCC4 | c.2509_2536dupCTTACACTTCACTTCCCCAGACTACGGA | p.Ile846ThrfsTer24 | frameshift | Exon 12 of 12 | ENSP00000507912.1 | A0A804HKF9 | |||
| ERCC4 | TSL:2 | n.1648_1675dupCTTACACTTCACTTCCCCAGACTACGGA | non_coding_transcript_exon | Exon 6 of 6 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at