rs397509401

Variant names:

• chr16-13947966-T-TCTTACACTTCACTTCCCCAGACTACGGA
• rs397509401
• NM_005236.3:c.2371_2398dupCTTACACTTCACTTCCCCAGACTACGGA

Variant summary

Our verdict is Likely pathogenic. The variant received 6 ACMG points: 6P and 0B. PVS1_Strong PP5_Moderate

The NM_005236.3(ERCC4):​c.2371_2398dupCTTACACTTCACTTCCCCAGACTACGGA​(p.Ile800ThrfsTer24) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: ERCC4 NM_005236.3 frameshift
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:3
• Conservation: PhyloP100: 7.35
• Publications: 1 publications found

Genes affected

ERCC4 (HGNC:3436): (ERCC excision repair 4, endonuclease catalytic subunit) The protein encoded by this gene forms a complex with ERCC1 and is involved in the 5' incision made during nucleotide excision repair. This complex is a structure specific DNA repair endonuclease that interacts with EME1. Defects in this gene are a cause of xeroderma pigmentosum complementation group F (XP-F), or xeroderma pigmentosum VI (XP6).[provided by RefSeq, Mar 2009]

ERCC4 Gene-Disease associations (from GenCC):

• xeroderma pigmentosum group F

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Genomics England PanelApp, G2P, ClinGen
• Fanconi anemia complementation group Q

  Inheritance: AR Classification: STRONG, MODERATE Submitted by: G2P, Labcorp Genetics (formerly Invitae), Ambry Genetics
• XFE progeroid syndrome

  Inheritance: AR Classification: STRONG Submitted by: Ambry Genetics
• Fanconi anemia

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• xeroderma pigmentosum

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• xeroderma pigmentosum-Cockayne syndrome complex

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_pathogenic. The variant received 6 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.128 CDS is truncated, and there are 1 pathogenic variants in the truncated region.
• PP5: Variant 16-13947966-T-TCTTACACTTCACTTCCCCAGACTACGGA is Pathogenic according to our data. Variant chr16-13947966-T-TCTTACACTTCACTTCCCCAGACTACGGA is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 55825.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ERCC4	NM_005236.3	c.2371_2398dupCTTACACTTCACTTCCCCAGACTACGGA	p.Ile800ThrfsTer24	frameshift_variant	Exon 11 of 11	ENST00000311895.8	NP_005227.1
ERCC4	XM_011522424.4	c.2509_2536dupCTTACACTTCACTTCCCCAGACTACGGA	p.Ile846ThrfsTer24	frameshift_variant	Exon 12 of 12		XP_011520726.1
ERCC4	XM_047433774.1	c.1582_1609dupCTTACACTTCACTTCCCCAGACTACGGA	p.Ile537ThrfsTer24	frameshift_variant	Exon 8 of 8		XP_047289730.1
ERCC4	XM_011522427.2	c.1021_1048dupCTTACACTTCACTTCCCCAGACTACGGA	p.Ile350ThrfsTer24	frameshift_variant	Exon 6 of 6		XP_011520729.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ERCC4	ENST00000311895.8	c.2371_2398dupCTTACACTTCACTTCCCCAGACTACGGA	p.Ile800ThrfsTer24	frameshift_variant	Exon 11 of 11	1	NM_005236.3	ENSP00000310520.7

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 32

GnomAD4 genome Cov.: 32

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:3

Revision: criteria provided, single submitter

Submissions by phenotype

Fanconi anemia complementation group Q Pathogenic:2

Oct 03, 2014

Leiden Open Variation Database

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: curation

Curator: Arleen D. Auerbach. Submitter to LOVD: Arleen D. Auerbach.

May 02, 2013

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

Xeroderma pigmentosum, group F Pathogenic:1

Feb 21, 2021

Undiagnosed Diseases Network, NIH

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.4
Mutation Taster		=4/196	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs397509401; hg19: chr16-14041823;