16-15720948-GCGTCCTCCGTGGCTTGCAGCT-G

Variant summary

Our verdict is Uncertain significance. Variant got 5 ACMG points: 5P and 0B. PM2PM4PP3

The NM_002474.3(MYH11):​c.4661_4681delAGCTGCAAGCCACGGAGGACG​(p.Glu1554_Asp1560del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

Frequency

Genomes: not found (cov: 31)

Consequence

MYH11
NM_002474.3 disruptive_inframe_deletion

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 10.0
Variant links:
Genes affected
MYH11 (HGNC:7569): (myosin heavy chain 11) The protein encoded by this gene is a smooth muscle myosin belonging to the myosin heavy chain family. The gene product is a subunit of a hexameric protein that consists of two heavy chain subunits and two pairs of non-identical light chain subunits. It functions as a major contractile protein, converting chemical energy into mechanical energy through the hydrolysis of ATP. A chromosomal rearrangement involving this gene is associated with acute myeloid leukemia of the M4Eo subtype. Mutations in this gene are associated with visceral myopathy, megacystis-microcolon-intestinal hypoperistalsis syndrome 2, and familial thoracic aortic aneurysm 4. [provided by RefSeq, May 2022]
NDE1 (HGNC:17619): (nudE neurodevelopment protein 1) This gene encodes a member of the nuclear distribution E (NudE) family of proteins. The encoded protein is localized at the centrosome and interacts with other centrosome components as part of a multiprotein complex that regulates dynein function. This protein plays an essential role in microtubule organization, mitosis and neuronal migration. Mutations in this gene cause lissencephaly 4, a disorder characterized by lissencephaly, severe brain atrophy, microcephaly, and severe cognitive disability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Uncertain_significance. Variant got 5 ACMG points.

PM2
Very rare variant in population databases, with high coverage;
PM4
Nonframeshift variant in NON repetitive region in NM_002474.3.
PP3
No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
MYH11NM_002474.3 linkc.4661_4681delAGCTGCAAGCCACGGAGGACG p.Glu1554_Asp1560del disruptive_inframe_deletion Exon 33 of 41 ENST00000300036.6 NP_002465.1 P35749-1A0A024QZJ4
MYH11NM_001040113.2 linkc.4682_4702delAGCTGCAAGCCACGGAGGACG p.Glu1561_Asp1567del disruptive_inframe_deletion Exon 34 of 43 ENST00000452625.7 NP_001035202.1 P35749-3
NDE1NM_017668.3 linkc.948-3234_948-3214delGTGGCTTGCAGCTCGTCCTCC intron_variant Intron 8 of 8 ENST00000396354.6 NP_060138.1 Q9NXR1-2X5DR54

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
MYH11ENST00000300036.6 linkc.4661_4681delAGCTGCAAGCCACGGAGGACG p.Glu1554_Asp1560del disruptive_inframe_deletion Exon 33 of 41 1 NM_002474.3 ENSP00000300036.5 P35749-1
MYH11ENST00000452625.7 linkc.4682_4702delAGCTGCAAGCCACGGAGGACG p.Glu1561_Asp1567del disruptive_inframe_deletion Exon 34 of 43 1 NM_001040113.2 ENSP00000407821.2 P35749-3
NDE1ENST00000396354.6 linkc.948-3234_948-3214delGTGGCTTGCAGCTCGTCCTCC intron_variant Intron 8 of 8 1 NM_017668.3 ENSP00000379642.1 Q9NXR1-2

Frequencies

GnomAD3 genomes
Cov.:
31
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
31

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Aortic aneurysm, familial thoracic 4 Uncertain:1
Mar 04, 2019
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Uncertain significance
Review Status: criteria provided, single submitter
Collection Method: clinical testing

This variant, c.4682_4702del, results in the deletion of 7 amino acids of the MYH11 protein (p.Glu1561_Asp1567del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (ExAC no frequency). This variant has not been reported in the literature in individuals with MYH11-related conditions. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the affected amino acid(s) is currently unknown. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1555551958; hg19: chr16-15814805; API