rs1555551958

Variant names:

• chr16-15720948-GCGTCCTCCGTGGCTTGCAGCT-G
• rs1555551958
• NM_002474.3:c.4661_4681delAGCTGCAAGCCACGGAGGACG

Your query was ambiguous. Multiple possible variants found:

• chr16-15720948-GCGTCCTCCGTGGCTTGCAGCT-G
• chr16-15720948-GCGTCCTCCGTGGCTTGCAGCT-GCGTCCTCCGTGGCTTGCAGCTCGTCCTCCGTGGCTTGCAGCT

Variant summary

Our verdict is Uncertain significance. Variant got 5 ACMG points: 5P and 0B. PM2 PM4 PP3

The NM_002474.3(MYH11):​c.4661_4681delAGCTGCAAGCCACGGAGGACG​(p.Glu1554_Asp1560del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 31)
• Consequence: MYH11 NM_002474.3 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 10.0

Genes affected

MYH11 (HGNC:7569): (myosin heavy chain 11) The protein encoded by this gene is a smooth muscle myosin belonging to the myosin heavy chain family. The gene product is a subunit of a hexameric protein that consists of two heavy chain subunits and two pairs of non-identical light chain subunits. It functions as a major contractile protein, converting chemical energy into mechanical energy through the hydrolysis of ATP. A chromosomal rearrangement involving this gene is associated with acute myeloid leukemia of the M4Eo subtype. Mutations in this gene are associated with visceral myopathy, megacystis-microcolon-intestinal hypoperistalsis syndrome 2, and familial thoracic aortic aneurysm 4. [provided by RefSeq, May 2022]

NDE1 (HGNC:17619): (nudE neurodevelopment protein 1) This gene encodes a member of the nuclear distribution E (NudE) family of proteins. The encoded protein is localized at the centrosome and interacts with other centrosome components as part of a multiprotein complex that regulates dynein function. This protein plays an essential role in microtubule organization, mitosis and neuronal migration. Mutations in this gene cause lissencephaly 4, a disorder characterized by lissencephaly, severe brain atrophy, microcephaly, and severe cognitive disability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]

ACMG classification

Verdict is Uncertain_significance. Variant got 5 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_002474.3.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MYH11	NM_002474.3	c.4661_4681delAGCTGCAAGCCACGGAGGACG	p.Glu1554_Asp1560del	disruptive_inframe_deletion	Exon 33 of 41	ENST00000300036.6	NP_002465.1
MYH11	NM_001040113.2	c.4682_4702delAGCTGCAAGCCACGGAGGACG	p.Glu1561_Asp1567del	disruptive_inframe_deletion	Exon 34 of 43	ENST00000452625.7	NP_001035202.1
NDE1	NM_017668.3	c.948-3234_948-3214delGTGGCTTGCAGCTCGTCCTCC		intron_variant	Intron 8 of 8	ENST00000396354.6	NP_060138.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MYH11	ENST00000300036.6	c.4661_4681delAGCTGCAAGCCACGGAGGACG	p.Glu1554_Asp1560del	disruptive_inframe_deletion	Exon 33 of 41	1	NM_002474.3	ENSP00000300036.5
MYH11	ENST00000452625.7	c.4682_4702delAGCTGCAAGCCACGGAGGACG	p.Glu1561_Asp1567del	disruptive_inframe_deletion	Exon 34 of 43	1	NM_001040113.2	ENSP00000407821.2
NDE1	ENST00000396354.6	c.948-3234_948-3214delGTGGCTTGCAGCTCGTCCTCC		intron_variant	Intron 8 of 8	1	NM_017668.3	ENSP00000379642.1

Frequencies

GnomAD3 genomes Cov.: 31

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 31

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Aortic aneurysm, familial thoracic 4 Uncertain:1

Mar 04, 2019

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.4682_4702del, results in the deletion of 7 amino acids of the MYH11 protein (p.Glu1561_Asp1567del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (ExAC no frequency). This variant has not been reported in the literature in individuals with MYH11-related conditions. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the affected amino acid(s) is currently unknown. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555551958; hg19: chr16-15814805;