16-19067700-TTGGCGGCTGCGCCCGGGGGCCCGGCGG-T

Variant names:

• chr16-19067700-TTGGCGGCTGCGCCCGGGGGCCCGGCGG-T
• NM_016138.5:c.38_64delGGCGGCTGCGCCCGGGGGCCCGGCGGT

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PM4

The NM_016138.5(COQ7):​c.38_64delGGCGGCTGCGCCCGGGGGCCCGGCGGT​(p.Trp13_Arg21del) variant causes a disruptive inframe deletion change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: COQ7 NM_016138.5 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 4.42

Genes affected

COQ7 (HGNC:2244): (coenzyme Q7, hydroxylase) The protein encoded by this gene is similar to a mitochondrial di-iron containing hydroxylase in Saccharomyces cerevisiae that is involved with ubiquinone biosynthesis. Mutations in the yeast gene lead to slower development and longer life span. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2010]

COQ7-DT (HGNC:55362): (COQ7 divergent transcript)

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_016138.5.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
COQ7	NM_016138.5	c.38_64delGGCGGCTGCGCCCGGGGGCCCGGCGGT	p.Trp13_Arg21del	disruptive_inframe_deletion	Exon 1 of 6	ENST00000321998.10	NP_057222.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
COQ7	ENST00000321998.10	c.38_64delGGCGGCTGCGCCCGGGGGCCCGGCGGT	p.Trp13_Arg21del	disruptive_inframe_deletion	Exon 1 of 6	1	NM_016138.5	ENSP00000322316.5

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Uncertain:1

Apr 10, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.38_64del, results in the deletion of 9 amino acid(s) of the COQ7 protein (p.Trp13_Arg21del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with COQ7-related conditions. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr16-19079022;