16-2048067-TAAGTGGCGGTCCCCACGGGGC-TAAGTGGCGGTCCCCACGGGGCAAGTGGCGGTCCCCACGGGGC

Variant names:

• chr16-2048067-T-TAAGTGGCGGTCCCCACGGGGC
• rs565651015
• NM_000548.5:c.-30+25_-30+45dupAGTGGCGGTCCCCACGGGGCA

Variant summary

Our verdict is Likely benign. The variant received -4 ACMG points: 0P and 4B. BS2

The ENST00000219476.9(TSC2):​c.-30+2_-30+3insAAGTGGCGGTCCCCACGGGGC variant causes a splice region, intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000112 in 1,426,470 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.0000066 (0 hom., cov: 32)
  • Exomes 𝑓: 0.000012 (0 hom.)
• Consequence: TSC2 ENST00000219476.9 splice_region, intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.402
• Publications: 0 publications found

Genes affected

TSC2 (HGNC:12363): (TSC complex subunit 2) This gene is a tumor suppressor gene that encodes the growth inhibitory protein tuberin. Tuberin interacts with hamartin to form the TSC protein complex which functions in the control of cell growth. This TSC protein complex negatively regulates mammalian target of rapamycin complex 1 (mTORC1) signaling which is a major regulator of anabolic cell growth. Mutations in this gene have been associated with tuberous sclerosis and lymphangioleiomyomatosis. [provided by RefSeq, May 2022]

NTHL1 (HGNC:8028): (nth like DNA glycosylase 1) The protein encoded by this gene is a DNA N-glycosylase of the endonuclease III family. Like a similar protein in E. coli, the encoded protein has DNA glycosylase activity on DNA substrates containing oxidized pyrimidine residues and has apurinic/apyrimidinic lyase activity. [provided by RefSeq, Oct 2008]

NTHL1 Gene-Disease associations (from GenCC):

• familial adenomatous polyposis 3

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, Genomics England PanelApp, Ambry Genetics
• NTHL1-deficiency tumor predisposition syndrome

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
• breast cancer

  Inheritance: AR Classification: LIMITED Submitted by: Ambry Genetics
• meningioma

  Inheritance: AR Classification: LIMITED Submitted by: Ambry Genetics

ACMG classification

Our verdict: Likely_benign. The variant received -4 ACMG points.

• BS2: High AC in GnomAdExome4 at 15 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TSC2	NM_000548.5	c.-30+25_-30+45dupAGTGGCGGTCCCCACGGGGCA		intron_variant	Intron 1 of 41	ENST00000219476.9	NP_000539.2
NTHL1	NM_002528.7	c.-265_-245dupGCCCCGTGGGGACCGCCACTT		upstream_gene_variant		ENST00000651570.2	NP_002519.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TSC2	ENST00000219476.9	c.-30+2_-30+3insAAGTGGCGGTCCCCACGGGGC		splice_region_variant, intron_variant	Intron 1 of 41	5	NM_000548.5	ENSP00000219476.3
NTHL1	ENST00000651570.2	c.-245_-244insGCCCCGTGGGGACCGCCACTT		upstream_gene_variant			NM_002528.7	ENSP00000498421.1

Frequencies

GnomAD3 genomes AF: 0.00000658 AC: 1 AN: 151906 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000194

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.0000118 AC: 15 AN: 1274564 Hom.: 0 Cov.: 31 AF XY: 0.0000145 AC XY: 9 AN XY: 619846

African (AFR) AF: 0.00 AC: 0 AN: 25410

American (AMR) AF: 0.00 AC: 0 AN: 19140

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 18438

East Asian (EAS) AF: 0.0000628 AC: 2 AN: 31866

South Asian (SAS) AF: 0.00 AC: 0 AN: 61718

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 31834

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 4202

European-Non Finnish (NFE) AF: 0.0000107 AC: 11 AN: 1029164

Other (OTH) AF: 0.0000379 AC: 2 AN: 52792

GnomAD4 genome AF: 0.00000658 AC: 1 AN: 151906 Hom.: 0 Cov.: 32 AF XY: 0.00 AC XY: 0 AN XY: 74178

African (AFR) AF: 0.00 AC: 0 AN: 41360

American (AMR) AF: 0.00 AC: 0 AN: 15278

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3466

East Asian (EAS) AF: 0.000194 AC: 1 AN: 5156

South Asian (SAS) AF: 0.00 AC: 0 AN: 4826

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10584

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 314

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 67920

Other (OTH) AF: 0.00 AC: 0 AN: 2090

Alfa AF: 0.0000540 Hom.: 0

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.40

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs565651015; hg19: chr16-2098068;