rs565651015

Variant names:

• chr16-2048067-TAAGTGGCGGTCCCCACGGGGC-T
• rs565651015
• NM_000548.5:c.-30+25_-30+45delAGTGGCGGTCCCCACGGGGCA

Your query was ambiguous. Multiple possible variants found:

• chr16-2048067-TAAGTGGCGGTCCCCACGGGGC-T
• chr16-2048067-TAAGTGGCGGTCCCCACGGGGC-TAAGTGGCGGTCCCCACGGGGCAAGTGGCGGTCCCCACGGGGC

Variant summary

Our verdict is Benign. Variant got -16 ACMG points: 0P and 16B. BP6_Very_Strong BS1 BS2

The ENST00000219476.9(TSC2):​c.-30+3_-30+23delAAGTGGCGGTCCCCACGGGGC variant causes a splice region, intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00147 in 1,426,560 control chromosomes in the GnomAD database, including 22 homozygotes. Variant has been reported in ClinVar as Likely benign (★★).

• Frequency:
  • Genomes: 𝑓 0.0053 (11 hom., cov: 32)
  • Exomes 𝑓: 0.0010 (11 hom.)
• Consequence: TSC2 ENST00000219476.9 splice_region, intron
• Clinical Significance: Benign/Likely benign criteria provided, multiple submitters, no conflicts B:2
• Conservation: PhyloP100: 0.421

Genes affected

TSC2 (HGNC:12363): (TSC complex subunit 2) This gene is a tumor suppressor gene that encodes the growth inhibitory protein tuberin. Tuberin interacts with hamartin to form the TSC protein complex which functions in the control of cell growth. This TSC protein complex negatively regulates mammalian target of rapamycin complex 1 (mTORC1) signaling which is a major regulator of anabolic cell growth. Mutations in this gene have been associated with tuberous sclerosis and lymphangioleiomyomatosis. [provided by RefSeq, May 2022]

NTHL1 (HGNC:8028): (nth like DNA glycosylase 1) The protein encoded by this gene is a DNA N-glycosylase of the endonuclease III family. Like a similar protein in E. coli, the encoded protein has DNA glycosylase activity on DNA substrates containing oxidized pyrimidine residues and has apurinic/apyrimidinic lyase activity. [provided by RefSeq, Oct 2008]

ACMG classification

Verdict is Benign. Variant got -16 ACMG points.

• BP6: Variant 16-2048067-TAAGTGGCGGTCCCCACGGGGC-T is Benign according to our data. Variant chr16-2048067-TAAGTGGCGGTCCCCACGGGGC-T is described in ClinVar as [Likely_benign]. Clinvar id is 670053.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars. Variant chr16-2048067-TAAGTGGCGGTCCCCACGGGGC-T is described in Lovd as [Benign].
• BS1: Variant frequency is greater than expected in population afr. gnomad4 allele frequency = 0.00526 (800/152008) while in subpopulation AFR AF= 0.0176 (731/41472). AF 95% confidence interval is 0.0166. There are 11 homozygotes in gnomad4. There are 379 alleles in male gnomad4 subpopulation. Median coverage is 32. This position pass quality control queck.
• BS2: High AC in GnomAd4 at 800 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TSC2	NM_000548.5	c.-30+25_-30+45delAGTGGCGGTCCCCACGGGGCA		intron_variant	Intron 1 of 41	ENST00000219476.9	NP_000539.2
NTHL1	NM_002528.7	c.-265_-245delGCCCCGTGGGGACCGCCACTT		upstream_gene_variant		ENST00000651570.2	NP_002519.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TSC2	ENST00000219476.9	c.-30+3_-30+23delAAGTGGCGGTCCCCACGGGGC		splice_region_variant, intron_variant	Intron 1 of 41	5	NM_000548.5	ENSP00000219476.3
NTHL1	ENST00000651570.2	c.-265_-245delGCCCCGTGGGGACCGCCACTT		upstream_gene_variant			NM_002528.7	ENSP00000498421.1

Frequencies

GnomAD3 genomes AF: 0.00527 AC: 800 AN: 151898 Hom.: 11 Cov.: 32

Gnomad AFR AF: 0.0177

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00118

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00330

Gnomad SAS AF: 0.000829

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000250

Gnomad OTH AF: 0.00622

GnomAD4 exome AF: 0.00102 AC: 1301 AN: 1274552 Hom.: 11 AF XY: 0.00100 AC XY: 621 AN XY: 619840

Gnomad4 AFR exome AF: 0.0194

Gnomad4 AMR exome AF: 0.000941

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.0114

Gnomad4 SAS exome AF: 0.000437

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.000332

Gnomad4 OTH exome AF: 0.00108

GnomAD4 genome AF: 0.00526 AC: 800 AN: 152008 Hom.: 11 Cov.: 32 AF XY: 0.00510 AC XY: 379 AN XY: 74296

Gnomad4 AFR AF: 0.0176

Gnomad4 AMR AF: 0.00118

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00331

Gnomad4 SAS AF: 0.000830

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.000250

Gnomad4 OTH AF: 0.00616

Alfa AF: 0.00367 Hom.: 0

Bravo AF: 0.00585

Asia WGS AF: 0.00289 AC: 10 AN: 3478

ClinVar

Significance: Benign/Likely benign

Submissions summary: Benign:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Benign:1

Jun 18, 2018

GeneDx

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant is considered likely benign or benign based on one or more of the following criteria: it is a conservative change, it occurs at a poorly conserved position in the protein, it is predicted to be benign by multiple in silico algorithms, and/or has population frequency not consistent with disease. -

Hereditary cancer-predisposing syndrome Benign:1

Oct 09, 2020

Sema4, Sema4

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: curation

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs565651015; hg19: chr16-2098068;