16-2088311-CGGCTCCGCCAGCGGGTAGGGAATATGG-CGGCTCCGCCAGCGGGTAGGGAATATGGGGCTCCGCCAGCGGGTAGGGAATATGG

Variant names:

• chr16-2088311-C-CGGCTCCGCCAGCGGGTAGGGAATATGG
• rs137854397
• ENST00000219476.9:c.5177_5178insGTAGGGAATATGGGGCTCCGCCAGCGG

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1 PM2

The ENST00000219476.9(TSC2):​c.5177_5178insGTAGGGAATATGGGGCTCCGCCAGCGG​(p.His1726delinsGlnTerGlyIleTrpGlySerAlaSerGly) variant causes a stop gained, disruptive inframe insertion change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency: Genomes: not found (cov: 34)
• Consequence: TSC2 ENST00000219476.9 stop_gained, disruptive_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:2
• Conservation: PhyloP100: 6.68

Genes affected

TSC2 (HGNC:12363): (TSC complex subunit 2) This gene is a tumor suppressor gene that encodes the growth inhibitory protein tuberin. Tuberin interacts with hamartin to form the TSC protein complex which functions in the control of cell growth. This TSC protein complex negatively regulates mammalian target of rapamycin complex 1 (mTORC1) signaling which is a major regulator of anabolic cell growth. Mutations in this gene have been associated with tuberous sclerosis and lymphangioleiomyomatosis. [provided by RefSeq, May 2022]

ACMG classification

Verdict is Pathogenic. Variant got 10 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most 50 bp of the penultimate exon, not predicted to undergo nonsense mediated mRNA decay. There are 84 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TSC2	NM_000548.5	c.5252_5259+19dupGCCAGCGGGTAGGGAATATGGGGCTCC		intron_variant	Intron 41 of 41	ENST00000219476.9	NP_000539.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TSC2	ENST00000219476.9	c.5177_5178insGTAGGGAATATGGGGCTCCGCCAGCGG	p.His1726delinsGlnTerGlyIleTrpGlySerAlaSerGly	stop_gained, disruptive_inframe_insertion	Exon 41 of 42	5	NM_000548.5	ENSP00000219476.3

Frequencies

GnomAD3 genomes Cov.: 34

GnomAD4 exome Cov.: 34

GnomAD4 genome Cov.: 34

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Tuberous sclerosis 2 Uncertain:1

Nov 14, 2019

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change falls in intron 41 of the TSC2 gene. It does not directly change the encoded amino acid sequence of the TSC2 protein, but it affects a nucleotide within the consensus splice site of the intron. This variant is not present in population databases (ExAC no frequency). This variant has not been reported in the literature in individuals with TSC2-related conditions. Nucleotide substitutions within the consensus splice site are a relatively common cause of aberrant splicing (PMID: 17576681, 9536098). Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may create or strengthen a splice site, but this prediction has not been confirmed by published transcriptional studies. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Lymphangiomyomatosis;C1846385:Isolated focal cortical dysplasia type II;C1860707:Tuberous sclerosis 2 Uncertain:1

Apr 28, 2024

Fulgent Genetics, Fulgent Genetics

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs137854397; hg19: chr16-2138312;