rs137854397
Variant summary
Our verdict is Pathogenic. The variant received 12 ACMG points: 12P and 0B. PVS1_StrongPP5_Very_Strong
The NM_000548.5(TSC2):c.5252_5259+19delGCCAGCGGGTAGGGAATATGGGGCTCC(p.Arg1751ProfsTer51) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. R1751R) has been classified as Likely benign.
Frequency
Consequence
NM_000548.5 frameshift, splice_donor, splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- tuberous sclerosisInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- tuberous sclerosis 2Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: PanelApp Australia, Laboratory for Molecular Medicine, Labcorp Genetics (formerly Invitae), G2P, Genomics England PanelApp, Ambry Genetics
- lymphangioleiomyomatosisInheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
- tuberous sclerosis complexInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 12 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000548.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TSC2 | NM_000548.5 | MANE Select | c.5252_5259+19delGCCAGCGGGTAGGGAATATGGGGCTCC | p.Arg1751ProfsTer51 | frameshift splice_donor splice_region intron | Exon 41 of 42 | NP_000539.2 | ||
| TSC2 | NM_001406663.1 | c.5249_5256+19delGCCAGCGGGTAGGGAATATGGGGCTCC | p.Arg1750ProfsTer51 | frameshift splice_donor splice_region intron | Exon 41 of 42 | NP_001393592.1 | |||
| TSC2 | NM_001114382.3 | c.5183_5190+19delGCCAGCGGGTAGGGAATATGGGGCTCC | p.Arg1728ProfsTer51 | frameshift splice_donor splice_region intron | Exon 40 of 41 | NP_001107854.1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TSC2 | ENST00000219476.9 | TSL:5 MANE Select | c.5246_5259+13delGGCTCCGCCAGCGGGTAGGGAATATGG | p.Arg1749ProfsTer51 | frameshift splice_donor splice_region intron | Exon 41 of 42 | ENSP00000219476.3 | ||
| TSC2 | ENST00000350773.9 | TSL:1 | c.5177_5190+13delGGCTCCGCCAGCGGGTAGGGAATATGG | p.Arg1726ProfsTer51 | frameshift splice_donor splice_region intron | Exon 40 of 41 | ENSP00000344383.4 | ||
| TSC2 | ENST00000401874.7 | TSL:1 | c.5045_5058+13delGGCTCCGCCAGCGGGTAGGGAATATGG | p.Arg1682ProfsTer51 | frameshift splice_donor splice_region intron | Exon 39 of 40 | ENSP00000384468.2 |
Frequencies
GnomAD3 genomes Cov.: 34
GnomAD4 genome Cov.: 34
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at