16-2088426-CAAGCCGCCTCTGCCTTCAGATCTGCGAGG-C
Variant summary
Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PVS1_Strong
The NM_000548.5(TSC2):c.5260-10_5278delCTGCCTTCAGATCTGCGAGGAAGCCGCCT(p.Ile1754fs) variant causes a frameshift, splice acceptor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000992 in 1,612,624 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. There is a variant allele frequency bias in the population database for this variant (GnomAdExome4), which may indicate mosaicism or somatic mutations in the reference population data. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. I1754I) has been classified as Likely benign.
Frequency
Consequence
NM_000548.5 frameshift, splice_acceptor, splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- tuberous sclerosisInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- tuberous sclerosis 2Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: PanelApp Australia, Laboratory for Molecular Medicine, Labcorp Genetics (formerly Invitae), G2P, Genomics England PanelApp, Ambry Genetics
- lymphangioleiomyomatosisInheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
- tuberous sclerosis complexInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 4 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes AF: 0.00000657 AC: 1AN: 152188Hom.: 0 Cov.: 33 show subpopulations
GnomAD2 exomes AF: 0.00000801 AC: 2AN: 249728 AF XY: 0.00000738 show subpopulations
GnomAD4 exome AF: 0.0000103 AC: 15AN: 1460436Hom.: 0 AF XY: 0.00000551 AC XY: 4AN XY: 726516 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
GnomAD4 genome AF: 0.00000657 AC: 1AN: 152188Hom.: 0 Cov.: 33 AF XY: 0.0000134 AC XY: 1AN XY: 74360 show subpopulations ⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.
ClinVar
Submissions by phenotype
Tuberous sclerosis syndrome Uncertain:1
This variant causes a deletion of 29 nucleotides in intron 41 and part of exon 42 of the TSC2 gene, abolishing the intron 42 splice acceptor site. Splice site prediction tools suggest that this variant may have a significant impact on RNA splicing. This variant is expected to remove all or part of exon 42 but the actual consequence has not been demonstrated by RNA studies and the variant is not expected to undergo nonsense mediated decay. To our knowledge, this variant has not been reported in individuals affected with TSC2-related disorders in the literature. This variant has been identified in 3/281100 chromosomes in the general population by the Genome Aggregation Database (gnomAD). Loss of TSC2 function is a known mechanism of disease (clinicalgenome.org). The available evidence is insufficient to determine the role of this variant in disease conclusively. Therefore, this variant is classified as a Variant of Uncertain Significance. -
Tuberous sclerosis 2 Uncertain:1
This variant results in the deletion of part of exon 42 (c.5260-10_5278del) of the TSC2 gene. RNA analysis indicates that this variant induces altered splicing and likely disrupts the C-terminus of the protein. This variant is present in population databases (rs756272343, gnomAD 0.01%). This variant has not been reported in the literature in individuals affected with TSC2-related conditions. ClinVar contains an entry for this variant (Variation ID: 535945). Variants that disrupt the consensus splice site are a relatively common cause of aberrant splicing (PMID: 17576681, 9536098). Studies have shown that this variant results in partial deletion of exon 42 and introduces a new termination codon (Invitae). However the mRNA is not expected to undergo nonsense-mediated decay. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
not provided Uncertain:1
Canonical splice site variant with an unclear effect on protein function; Has not been previously published as pathogenic or benign to our knowledge -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at