rs756272343

Variant names:

• chr16-2088426-CAAGCCGCCTCTGCCTTCAGATCTGCGAGG-C
• rs756272343
• ENST00000439117.6:n.*4427-19_*4436delAAGCCGCCTCTGCCTTCAGATCTGCGAGG

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The ENST00000439117.6(TSC2):​n.*4427-19_*4436delAAGCCGCCTCTGCCTTCAGATCTGCGAGG variant causes a splice region, non coding transcript exon change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000992 in 1,612,624 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. There is a variant allele frequency bias in the population database for this variant (GnomAdExome4), which may indicate mosaicism or somatic mutations in the reference population data. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency:
  • Genomes: 𝑓 0.0000066 (0 hom., cov: 33)
  • Exomes 𝑓: 0.000010 (0 hom.)
• Consequence: TSC2 ENST00000439117.6 splice_region, non_coding_transcript_exon
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:4
• Conservation: PhyloP100: 0.667
• Publications: 0 publications found

Genes affected

TSC2 (HGNC:12363): (TSC complex subunit 2) This gene is a tumor suppressor gene that encodes the growth inhibitory protein tuberin. Tuberin interacts with hamartin to form the TSC protein complex which functions in the control of cell growth. This TSC protein complex negatively regulates mammalian target of rapamycin complex 1 (mTORC1) signaling which is a major regulator of anabolic cell growth. Mutations in this gene have been associated with tuberous sclerosis and lymphangioleiomyomatosis. [provided by RefSeq, May 2022]

TSC2 Gene-Disease associations (from GenCC):

• tuberous sclerosis

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• tuberous sclerosis 2

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: PanelApp Australia, Laboratory for Molecular Medicine, Labcorp Genetics (formerly Invitae), G2P, Genomics England PanelApp, Ambry Genetics
• lymphangioleiomyomatosis

  Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
• tuberous sclerosis complex

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000439117.6. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TSC2	NM_000548.5	MANE Select	c.5260-10_5278delCTGCCTTCAGATCTGCGAGGAAGCCGCCT	p.Ile1754fs	frameshift splice_acceptor splice_region intron	Exon 42 of 42	NP_000539.2
	TSC2	NM_001406663.1		c.5257-10_5275delCTGCCTTCAGATCTGCGAGGAAGCCGCCT	p.Ile1753fs	frameshift splice_acceptor splice_region intron	Exon 42 of 42	NP_001393592.1
	TSC2	NM_001114382.3		c.5191-10_5209delCTGCCTTCAGATCTGCGAGGAAGCCGCCT	p.Ile1731fs	frameshift splice_acceptor splice_region intron	Exon 41 of 41	NP_001107854.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TSC2	ENST00000439117.6	TSL:1	n.*4427-19_*4436delAAGCCGCCTCTGCCTTCAGATCTGCGAGG		splice_region non_coding_transcript_exon	Exon 38 of 38	ENSP00000406980.2
	TSC2	ENST00000219476.9	TSL:5 MANE Select	c.5260-19_5269delAAGCCGCCTCTGCCTTCAGATCTGCGAGG	p.Ile1754fs	frameshift splice_acceptor splice_region intron	Exon 42 of 42	ENSP00000219476.3
	TSC2	ENST00000350773.9	TSL:1	c.5191-19_5200delAAGCCGCCTCTGCCTTCAGATCTGCGAGG	p.Ile1731fs	frameshift splice_acceptor splice_region intron	Exon 41 of 41	ENSP00000344383.4

Frequencies

GnomAD3 genomes AF: 0.00000657 AC: 1 AN: 152188 Hom.: 0 Cov.: 33

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.0000941

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.00000801 AC: 2 AN: 249728 AF XY: 0.00000738

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.0000927

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.0000103 AC: 15 AN: 1460436 Hom.: 0 AF XY: 0.00000551 AC XY: 4 AN XY: 726516

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 33480

American (AMR) AF: 0.00 AC: 0 AN: 44722

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26134

East Asian (EAS) AF: 0.00 AC: 0 AN: 39700

South Asian (SAS) AF: 0.00 AC: 0 AN: 86254

European-Finnish (FIN) AF: 0.000250 AC: 13 AN: 52000

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 0.00000180 AC: 2 AN: 1111998

Other (OTH) AF: 0.00 AC: 0 AN: 60380

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.000000000000133782), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.00000657 AC: 1 AN: 152188 Hom.: 0 Cov.: 33 AF XY: 0.0000134 AC XY: 1 AN XY: 74360

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 41442

American (AMR) AF: 0.00 AC: 0 AN: 15278

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3470

East Asian (EAS) AF: 0.00 AC: 0 AN: 5190

South Asian (SAS) AF: 0.00 AC: 0 AN: 4838

European-Finnish (FIN) AF: 0.0000941 AC: 1 AN: 10622

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 68030

Other (OTH) AF: 0.00 AC: 0 AN: 2090

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5. (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

ClinVar

ClinVar submissions as Germline

Significance: Uncertain significance

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	2	-	not provided (2)
-	1	-	Tuberous sclerosis 2 (1)
-	1	-	Tuberous sclerosis syndrome (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.67
BranchPoint Hunter		4.0
Mutation Taster		=14/186	disease causing (long InDel)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs756272343; hg19: chr16-2138427;