rs756272343

Variant names:

• chr16-2088426-CAAGCCGCCTCTGCCTTCAGATCTGCGAGG-C
• rs756272343
• NM_000548.5:c.5260-10_5278delCTGCCTTCAGATCTGCGAGGAAGCCGCCT

Variant summary

Our verdict is Uncertain significance. Variant got 0 ACMG points: 4P and 4B. PVS1_Strong BS2

The NM_000548.5(TSC2):​c.5260-10_5278delCTGCCTTCAGATCTGCGAGGAAGCCGCCT​(p.Ile1754fs) variant causes a frameshift, splice acceptor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000992 in 1,612,624 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. I1754I) has been classified as Benign.

• Frequency:
  • Genomes: 𝑓 0.0000066 (0 hom., cov: 33)
  • Exomes 𝑓: 0.000010 (0 hom.)
• Consequence: TSC2 NM_000548.5 frameshift, splice_acceptor, splice_region, intron
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:3
• Conservation: PhyloP100: 0.667

Genes affected

TSC2 (HGNC:12363): (TSC complex subunit 2) This gene is a tumor suppressor gene that encodes the growth inhibitory protein tuberin. Tuberin interacts with hamartin to form the TSC protein complex which functions in the control of cell growth. This TSC protein complex negatively regulates mammalian target of rapamycin complex 1 (mTORC1) signaling which is a major regulator of anabolic cell growth. Mutations in this gene have been associated with tuberous sclerosis and lymphangioleiomyomatosis. [provided by RefSeq, May 2022]

ACMG classification

Verdict is Uncertain_significance. Variant got 0 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 14 pathogenic variants in the truncated region.
• BS2: High AC in GnomAdExome4 at 15 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TSC2	NM_000548.5	c.5260-10_5278delCTGCCTTCAGATCTGCGAGGAAGCCGCCT	p.Ile1754fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	Exon 42 of 42	ENST00000219476.9	NP_000539.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TSC2	ENST00000219476.9	c.5260-19_5269delAAGCCGCCTCTGCCTTCAGATCTGCGAGG	p.Ile1754fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	Exon 42 of 42	5	NM_000548.5	ENSP00000219476.3

Frequencies

GnomAD3 genomes AF: 0.00000657 AC: 1 AN: 152188 Hom.: 0 Cov.: 33

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.0000941

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD3 exomes AF: 0.00000801 AC: 2 AN: 249728 Hom.: 0 AF XY: 0.00000738 AC XY: 1 AN XY: 135558

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.00

Gnomad FIN exome AF: 0.0000927

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.0000103 AC: 15 AN: 1460436 Hom.: 0 AF XY: 0.00000551 AC XY: 4 AN XY: 726516

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.000250

Gnomad4 NFE exome AF: 0.00000180

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome AF: 0.00000657 AC: 1 AN: 152188 Hom.: 0 Cov.: 33 AF XY: 0.0000134 AC XY: 1 AN XY: 74360

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.0000941

Gnomad4 NFE AF: 0.00

Gnomad4 OTH AF: 0.00

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Tuberous sclerosis syndrome Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

All of Us Research Program, National Institutes of Health

Sep 17, 2023

This variant causes a deletion of 29 nucleotides in intron 41 and part of exon 42 of the TSC2 gene, abolishing the intron 42 splice acceptor site. Splice site prediction tools suggest that this variant may have a significant impact on RNA splicing. This variant is expected to remove all or part of exon 42 but the actual consequence has not been demonstrated by RNA studies and the variant is not expected to undergo nonsense mediated decay. To our knowledge, this variant has not been reported in individuals affected with TSC2-related disorders in the literature. This variant has been identified in 3/281100 chromosomes in the general population by the Genome Aggregation Database (gnomAD). Loss of TSC2 function is a known mechanism of disease (clinicalgenome.org). The available evidence is insufficient to determine the role of this variant in disease conclusively. Therefore, this variant is classified as a Variant of Uncertain Significance. -

Tuberous sclerosis 2 Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Aug 14, 2024

This variant results in the deletion of part of exon 42 (c.5260-10_5278del) of the TSC2 gene. RNA analysis indicates that this variant induces altered splicing and likely disrupts the C-terminus of the protein. This variant is present in population databases (rs756272343, gnomAD 0.01%). This variant has not been reported in the literature in individuals affected with TSC2-related conditions. ClinVar contains an entry for this variant (Variation ID: 535945). Variants that disrupt the consensus splice site are a relatively common cause of aberrant splicing (PMID: 17576681, 9536098). Studies have shown that this variant results in partial deletion of exon 42 and introduces a new termination codon (Invitae). However the mRNA is not expected to undergo nonsense-mediated decay. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

not provided Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

GeneDx

May 14, 2024

Canonical splice site variant with an unclear effect on protein function; Has not been previously published as pathogenic or benign to our knowledge -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
BranchPoint Hunter		4.0

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs756272343; hg19: chr16-2138427;