Our verdict is Uncertain significance. Variant got 0 ACMG points: 4P and 4B. PVS1_StrongBS2
The NM_000548.5(TSC2):c.5260-10_5278delCTGCCTTCAGATCTGCGAGGAAGCCGCCT(p.Ile1754fs) variant causes a frameshift, splice acceptor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000992 in 1,612,624 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. I1754I) has been classified as Likely benign.
TSC2 (HGNC:12363): (TSC complex subunit 2) This gene is a tumor suppressor gene that encodes the growth inhibitory protein tuberin. Tuberin interacts with hamartin to form the TSC protein complex which functions in the control of cell growth. This TSC protein complex negatively regulates mammalian target of rapamycin complex 1 (mTORC1) signaling which is a major regulator of anabolic cell growth. Mutations in this gene have been associated with tuberous sclerosis and lymphangioleiomyomatosis. [provided by RefSeq, May 2022]
Verdict is Uncertain_significance. Variant got 0 ACMG points.
PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 19 pathogenic variants in the truncated region.
All of Us Research Program, National Institutes of Health
Significance: Uncertain significance
Review Status: criteria provided, single submitter
Collection Method: clinical testing
This variant causes a deletion of 29 nucleotides in intron 41 and part of exon 42 of the TSC2 gene, abolishing the intron 42 splice acceptor site. Splice site prediction tools suggest that this variant may have a significant impact on RNA splicing. This variant is expected to remove all or part of exon 42 but the actual consequence has not been demonstrated by RNA studies and the variant is not expected to undergo nonsense mediated decay. To our knowledge, this variant has not been reported in individuals affected with TSC2-related disorders in the literature. This variant has been identified in 3/281100 chromosomes in the general population by the Genome Aggregation Database (gnomAD). Loss of TSC2 function is a known mechanism of disease (clinicalgenome.org). The available evidence is insufficient to determine the role of this variant in disease conclusively. Therefore, this variant is classified as a Variant of Uncertain Significance. -
Tuberous sclerosis 2 Uncertain:1
Aug 14, 2024
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Uncertain significance
Review Status: criteria provided, single submitter
Collection Method: clinical testing
This variant results in the deletion of part of exon 42 (c.5260-10_5278del) of the TSC2 gene. RNA analysis indicates that this variant induces altered splicing and likely disrupts the C-terminus of the protein. This variant is present in population databases (rs756272343, gnomAD 0.01%). This variant has not been reported in the literature in individuals affected with TSC2-related conditions. ClinVar contains an entry for this variant (Variation ID: 535945). Variants that disrupt the consensus splice site are a relatively common cause of aberrant splicing (PMID: 17576681, 9536098). Studies have shown that this variant results in partial deletion of exon 42 and introduces a new termination codon (Invitae). However the mRNA is not expected to undergo nonsense-mediated decay. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
not provided Uncertain:1
May 14, 2024
GeneDx
Significance: Uncertain significance
Review Status: criteria provided, single submitter
Collection Method: clinical testing
Canonical splice site variant with an unclear effect on protein function; Has not been previously published as pathogenic or benign to our knowledge -