16-2091474-G-GGGGCGGACGCTGAGGGCGGCCAGGGCGC

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1PM2PP5_Very_Strong

The NM_001009944.3(PKD1):​c.11633_11660dupGCGCCCTGGCCGCCCTCAGCGTCCGCCC​(p.Phe3888fs) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★★). Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 33)

Consequence

PKD1
NM_001009944.3 frameshift

Scores

Not classified

Clinical Significance

Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:2

Conservation

PhyloP100: 5.01
Variant links:
Genes affected
PKD1 (HGNC:9008): (polycystin 1, transient receptor potential channel interacting) This gene encodes a member of the polycystin protein family. The encoded glycoprotein contains a large N-terminal extracellular region, multiple transmembrane domains and a cytoplasmic C-tail. It is an integral membrane protein that functions as a regulator of calcium permeable cation channels and intracellular calcium homoeostasis. It is also involved in cell-cell/matrix interactions and may modulate G-protein-coupled signal-transduction pathways. It plays a role in renal tubular development, and mutations in this gene cause autosomal dominant polycystic kidney disease type 1 (ADPKD1). ADPKD1 is characterized by the growth of fluid-filled cysts that replace normal renal tissue and result in end-stage renal failure. Splice variants encoding different isoforms have been noted for this gene. Also, six pseudogenes, closely linked in a known duplicated region on chromosome 16p, have been described. [provided by RefSeq, Oct 2008]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 18 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 16-2091474-G-GGGGCGGACGCTGAGGGCGGCCAGGGCGC is Pathogenic according to our data. Variant chr16-2091474-G-GGGGCGGACGCTGAGGGCGGCCAGGGCGC is described in ClinVar as [Likely_pathogenic]. Clinvar id is 1687355.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect #exon/exons MANE Protein UniProt
PKD1NM_001009944.3 linkuse as main transcriptc.11633_11660dupGCGCCCTGGCCGCCCTCAGCGTCCGCCC p.Phe3888fs frameshift_variant 42/46 ENST00000262304.9 NP_001009944.3

Ensembl

Gene Transcript HGVSc HGVSp Effect #exon/exons TSL MANE Protein Appris UniProt
PKD1ENST00000262304.9 linkuse as main transcriptc.11633_11660dupGCGCCCTGGCCGCCCTCAGCGTCCGCCC p.Phe3888fs frameshift_variant 42/461 NM_001009944.3 ENSP00000262304.4 P98161-1

Frequencies

GnomAD3 genomes
Cov.:
33
GnomAD4 exome
Cov.:
32
GnomAD4 genome
Cov.:
33

ClinVar

Significance: Pathogenic/Likely pathogenic
Submissions summary: Pathogenic:2
Revision: criteria provided, multiple submitters, no conflicts
LINK: link

Submissions by phenotype

Polycystic kidney disease, adult type Pathogenic:1
Likely pathogenic, criteria provided, single submitterclinical testing3billionMay 22, 2022The variant is not observed in the gnomAD v2.1.1 dataset. Frameshift: predicted to result in a loss or disruption of normal protein function through nonsense-mediated decay (NMD) or protein truncation. Multiple pathogenic variants are reported downstream of the variant. Therefore, this variant is classified as likely pathogenic according to the recommendation of ACMG/AMP guideline. -
not provided Pathogenic:1
Pathogenic, criteria provided, single submitterclinical testingAthena DiagnosticsDec 07, 2021This variant is expected to result in the loss of a functional protein. This variant has not been reported in large, multi-ethnic general populations (http://gnomad.broadinstitute.org). This variant has been identified in at least one individual tested at Athena Diagnostics with clinical features associated with this gene. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr16-2141475; API