16-2091474-G-GGGGCGGACGCTGAGGGCGGCCAGGGCGC

Variant names:

• chr16-2091474-G-GGGGCGGACGCTGAGGGCGGCCAGGGCGC
• NM_001009944.3:c.11633_11660dupGCGCCCTGGCCGCCCTCAGCGTCCGCCC

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1 PM2 PP5_Very_Strong

The NM_001009944.3(PKD1):​c.11633_11660dupGCGCCCTGGCCGCCCTCAGCGTCCGCCC​(p.Phe3888ArgfsTer82) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 33)
• Consequence: PKD1 NM_001009944.3 frameshift
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:3
• Conservation: PhyloP100: 5.01

Genes affected

PKD1 (HGNC:9008): (polycystin 1, transient receptor potential channel interacting) This gene encodes a member of the polycystin protein family. The encoded glycoprotein contains a large N-terminal extracellular region, multiple transmembrane domains and a cytoplasmic C-tail. It is an integral membrane protein that functions as a regulator of calcium permeable cation channels and intracellular calcium homoeostasis. It is also involved in cell-cell/matrix interactions and may modulate G-protein-coupled signal-transduction pathways. It plays a role in renal tubular development, and mutations in this gene cause autosomal dominant polycystic kidney disease type 1 (ADPKD1). ADPKD1 is characterized by the growth of fluid-filled cysts that replace normal renal tissue and result in end-stage renal failure. Splice variants encoding different isoforms have been noted for this gene. Also, six pseudogenes, closely linked in a known duplicated region on chromosome 16p, have been described. [provided by RefSeq, Oct 2008]

PKD1-AS1 (HGNC:56035): (PKD1 antisense RNA 1)

ACMG classification

Verdict is Pathogenic. Variant got 18 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 16-2091474-G-GGGGCGGACGCTGAGGGCGGCCAGGGCGC is Pathogenic according to our data. Variant chr16-2091474-G-GGGGCGGACGCTGAGGGCGGCCAGGGCGC is described in ClinVar as [Likely_pathogenic]. Clinvar id is 1687355.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PKD1	NM_001009944.3	c.11633_11660dupGCGCCCTGGCCGCCCTCAGCGTCCGCCC	p.Phe3888ArgfsTer82	frameshift_variant	Exon 42 of 46	ENST00000262304.9	NP_001009944.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PKD1	ENST00000262304.9	c.11633_11660dupGCGCCCTGGCCGCCCTCAGCGTCCGCCC	p.Phe3888ArgfsTer82	frameshift_variant	Exon 42 of 46	1	NM_001009944.3	ENSP00000262304.4

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 32

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Pathogenic:2

Dec 07, 2021

Athena Diagnostics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant is expected to result in the loss of a functional protein. This variant has not been reported in large, multi-ethnic general populations (http://gnomad.broadinstitute.org). This variant has been identified in at least one individual tested at Athena Diagnostics with clinical features associated with this gene. -

Aug 08, 2024

GeneDx

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss of function is a known mechanism of disease; Not observed at significant frequency in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: 22508176) -

Polycystic kidney disease, adult type Pathogenic:1

May 22, 2022

3billion, Medical Genetics

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The variant is not observed in the gnomAD v2.1.1 dataset. Frameshift: predicted to result in a loss or disruption of normal protein function through nonsense-mediated decay (NMD) or protein truncation. Multiple pathogenic variants are reported downstream of the variant. Therefore, this variant is classified as likely pathogenic according to the recommendation of ACMG/AMP guideline. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr16-2141475;