16-2111546-GCGCACATCCGCCTGGGCCGC-G

Variant names:

• chr16-2111546-GCGCACATCCGCCTGGGCCGC-G
• rs778028967
• NM_001009944.3:c.3601_3620delGCGGCCCAGGCGGATGTGCG

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_001009944.3(PKD1):​c.3601_3620delGCGGCCCAGGCGGATGTGCG​(p.Ala1201ArgfsTer3) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 6.9e-7 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: PKD1 NM_001009944.3 frameshift
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:2
• Conservation: PhyloP100: 5.59
• Publications: 1 publications found

Genes affected

PKD1 (HGNC:9008): (polycystin 1, transient receptor potential channel interacting) This gene encodes a member of the polycystin protein family. The encoded glycoprotein contains a large N-terminal extracellular region, multiple transmembrane domains and a cytoplasmic C-tail. It is an integral membrane protein that functions as a regulator of calcium permeable cation channels and intracellular calcium homoeostasis. It is also involved in cell-cell/matrix interactions and may modulate G-protein-coupled signal-transduction pathways. It plays a role in renal tubular development, and mutations in this gene cause autosomal dominant polycystic kidney disease type 1 (ADPKD1). ADPKD1 is characterized by the growth of fluid-filled cysts that replace normal renal tissue and result in end-stage renal failure. Splice variants encoding different isoforms have been noted for this gene. Also, six pseudogenes, closely linked in a known duplicated region on chromosome 16p, have been described. [provided by RefSeq, Oct 2008]

PKD1 Gene-Disease associations (from GenCC):

• autosomal dominant polycystic kidney disease

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
• polycystic kidney disease 1

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Laboratory for Molecular Medicine, Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
• autosomal recessive polycystic kidney disease

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
• Caroli disease

  Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 16-2111546-GCGCACATCCGCCTGGGCCGC-G is Pathogenic according to our data. Variant chr16-2111546-GCGCACATCCGCCTGGGCCGC-G is described in ClinVar as Pathogenic. ClinVar VariationId is 586270.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PKD1	NM_001009944.3	c.3601_3620delGCGGCCCAGGCGGATGTGCG	p.Ala1201ArgfsTer3	frameshift_variant	Exon 15 of 46	ENST00000262304.9	NP_001009944.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PKD1	ENST00000262304.9	c.3601_3620delGCGGCCCAGGCGGATGTGCG	p.Ala1201ArgfsTer3	frameshift_variant	Exon 15 of 46	1	NM_001009944.3	ENSP00000262304.4

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD2 exomes AF: 0.00000481 AC: 1 AN: 208056 AF XY: 0.00

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000112

Gnomad OTH exome AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 6.93e-7 AC: 1 AN: 1442132 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 716214

African (AFR) AF: 0.00 AC: 0 AN: 33098

American (AMR) AF: 0.00 AC: 0 AN: 42228

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 25718

East Asian (EAS) AF: 0.00 AC: 0 AN: 38706

South Asian (SAS) AF: 0.00 AC: 0 AN: 84072

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 50320

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 4984

European-Non Finnish (NFE) AF: 9.06e-7 AC: 1 AN: 1103532

Other (OTH) AF: 0.00 AC: 0 AN: 59474

GnomAD4 genome Cov.: 33

Alfa AF: 0.000111 Hom.: 0

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Polycystic kidney disease, adult type Pathogenic:1

Jan 30, 2024

Fulgent Genetics, Fulgent Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

not provided Pathogenic:1

Apr 18, 2018

Athena Diagnostics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.6
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs778028967; hg19: chr16-2161547;