chr16-2111546-GCGCACATCCGCCTGGGCCGC-G
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_001009944.3(PKD1):c.3601_3620delGCGGCCCAGGCGGATGTGCG(p.Ala1201ArgfsTer3) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_001009944.3 frameshift
Scores
Clinical Significance
Conservation
Publications
- autosomal dominant polycystic kidney diseaseInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
- polycystic kidney disease 1Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Laboratory for Molecular Medicine, Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
- autosomal recessive polycystic kidney diseaseInheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
- Caroli diseaseInheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001009944.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PKD1 | TSL:1 MANE Select | c.3601_3620delGCGGCCCAGGCGGATGTGCG | p.Ala1201ArgfsTer3 | frameshift | Exon 15 of 46 | ENSP00000262304.4 | P98161-1 | ||
| PKD1 | TSL:1 | c.3601_3620delGCGGCCCAGGCGGATGTGCG | p.Ala1201ArgfsTer3 | frameshift | Exon 15 of 46 | ENSP00000399501.1 | P98161-3 | ||
| PKD1 | TSL:5 | c.471-3208_471-3189delGCGGCCCAGGCGGATGTGCG | intron | N/A | ENSP00000456672.1 | H3BSE9 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD2 exomes AF: 0.00000481 AC: 1AN: 208056 AF XY: 0.00 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 6.93e-7 AC: 1AN: 1442132Hom.: 0 AF XY: 0.00 AC XY: 0AN XY: 716214 show subpopulations
GnomAD4 genome Cov.: 33
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at